Gossner, Anton

Hopkins, John

English

Bursts of synaptic transmission are known to induce transient depletion of Ca2+ within the synaptic cleft. Although Ca2+ depletion has been shown to lower presynaptic release probability, effects on the postsynaptic cell have not been reported. In this study, we show that physiologically relevant reductions in extracellular Ca2+ lead to a decrease in synaptic strength between synaptically coupled layer 2/3 cortical pyramidal neurons. Using quantal analysis and mEPSP analysis, we demonstrate that a lowered extracellular Ca2+ produces a reduction in the postsynaptic quantal size in addition to its known effect on release probability. An elevated Mg2+ level can prevent this reduction in postsynaptic efficacy at subphysiological Ca2+ levels. We show that the calcium-dependent effect on postsynaptic quantal size is mediated by group 1 metabotropic glutamate receptors, acting via CaMKII (Ca2+/calmodulin-dependent protein kinase II) and PKC. Therefore, physiologically relevant changes in extracellular Ca2+ can regulate information transfer at cortical synapses via both presynaptic and postsynaptic mechanisms

Edinburgh Research Explorer

     Edinburgh Research Explorer                                      Incremental generation of an EST set for the analysis of scrapiepathogenesis.Citation for published version:Gossner, A & Hopkins, J 2008, 'Incremental generation of an EST set for the analysis of scrapiepathogenesis.' Small Ruminant Research, vol 81, no. 1, pp. 75-78.Link:Link to publication record in Edinburgh Research ExplorerDocument Version:Publisher final version (usually the publisher pdf)Published In:Small Ruminant ResearchPublisher Rights Statement:© 2008 ElsevierGeneral rightsCopyright for the publications made accessible via the Edinburgh Research Explorer is retained by the author(s)and / or other copyright owners and it is a condition of accessing these publications that users recognise andabide by the legal requirements associated with these rights.Take down policyThe University of Edinburgh has made every reasonable effort to ensure that Edinburgh Research Explorercontent complies with UK legislation. If you believe that the public display of this file breaches copyright pleasecontact openaccess@ed.ac.uk providing details, and we will remove access to the work immediately andinvestigate your claim.Download date: 20. Feb. 2015This article appeared in a journal published by Elsevier. The attachedcopy is furnished to the author for internal non-commercial researchand education use, including for instruction at the authors institutionand sharing with colleagues.Other uses, including reproduction and distribution, or selling orlicensing copies, or posting to personal, institutional or third partywebsites are prohibited.In most cases authors are permitted to post their version of thearticle (e.g. in Word or Tex form) to their personal website orinstitutional repository. Authors requiring further informationregarding Elsevier’s archiving and manuscript policies areencouraged to visit:http://www.elsevier.com/copyrightAuthor's personal copySmall Ruminant Research 81 (2009) 75–78Contents lists available at ScienceDirectSmall Ruminant Researchjourna l homepage: www.e lsev ier .com/ locate /smal l rumresShort communicationIncremental generation of an EST set for the analysis of scrapiepathogenesisA.G. Gossner ∗, J. HopkinsThe Roslin Institute, Royal (Dick) School of Veterinary Studies, University of Edinburgh, Summerhall, Edinburgh EH9 1QH, UKa r t i c l e i n f oArticle history:Received 29 July 2008Received in revised form 24 October 2008Accepted 17 November 2008Keywords:OvineMicroarraycDNA libraryScrapiea b s t r a c tAs part of a functional genomic study of scrapie pathogenesis we have generated a complexnon-redundant microarray from several tissues by the selection of unique clones and theincremental augmentation of the expressed sequence tag sets. The base set of about 15,000expressed sequence tags had minimum redundancy and originated from bovine brain. Theaim was to augment this set with clones from scrapie-infected brain and spleen and unin-fected spleen with minimum redundancy. This was achieved by macroarray hybridizationto identify unique sequences in the ovine library. Quality sequence of 4052 unique sheepclones were obtained from the sequencing of only 5000 which have been submitted to thedbEST database at GenBank.© 2008 Elsevier B.V. All rights reserved.1. IntroductionScrapie is a naturally occurring infectious diseaseof sheep and is the prototype transmissible spongi-form encephalopathy (TSE), a group of diseases thatalso includes the human Creutzfeldt–Jakob diseases (CJD),bovine spongiform encephalopathy (BSE) and chronicwasting disease (CWD). The TSEs are characterized by thealteration of a normal membrane protein PrP; from itsmostly -helical conformation (PrPC), to a protease resis-tant ﬁbrillar form (PrPSC), largely consisting of -sheetstructure (Riek et al., 1997). The disease-associated con-version of PrPC to PrPSC is associated with TSE infectivity(Prusiner, 1982; Scott et al., 1997) although the link is notabsolute (Barron et al., 2007). The main target organ forscrapie is the brain, but studies in mice also indicate thatfollicular dendritic cells of the spleen are necessary forprion propagation in the lymphoreticular system (Brownet al., 1999). Scrapie pathogenesis is still not completelyunderstoodand theuseof functional genomicswouldallow∗ Corresponding author. Tel.: +44 131 650 7943; fax: +44 131 650 6511.E-mail address: A.Gossner@ed.ac.uk (A.G. Gossner).for themolecular basis of disease development to be betterunderstood.The use of microarrays permits simultaneous measure-ment of the expression of thousands of transcripts eachof which requires sequence data for annotation. To pro-vide a relevant resource for this study requires expressedsequence tags (ESTs) from all target tissues. However, thegeneration of separate annotated EST sets from each tissueis uneconomical and the simple addition of EST sets pro-duces excessive redundancy. For this study we exploited apartially annotated bovine brain EST set, with a low levelof redundancy, and augmented it incrementally with ESTsfrom scrapie-infected brain and spleen, and uninfectedspleen.2. Materials and methods2.1. Preparation of mRNATotal RNAwas extracted, using the RiboPureTM Kit (Ambion, Warring-ton, UK), frommedulla (obex) and spleen from twoCheviot sheep showingclinical signs of natural scrapie, and from the spleen of three normal non-scrapie sheep. RNAquality and integritywas assessedusing aRNALabChipon the Agilent 2100 bioanalyser (Agilent, Stockport, UK). The isolated totalRNA was pooled and then used to prepare poly-A mRNA with Poly (A)PuristTM MAG Kit as described by the manufacture (Ambion).0921-4488/$ – see front matter © 2008 Elsevier B.V. All rights reserved.doi:10.1016/j.smallrumres.2008.11.005Author's personal copy76 A.G. Gossner, J. Hopkins / Small Ruminant Research 81 (2009) 75–782.2. Construction of cDNA librariesA directionally cloned cDNA library was constructed using CreatorTMSMARTTM Kit (Clontech, Saint-Germain-en-Laye, France) cloned into SﬁI-digested pDNR-LIB vector. Recombinant pDNR-LIB vector were usedto transform ElectroMaxTM DH5-ETM competent cells by electropora-tion (Invitrogen Ltd., Paisley, UK). Another directional cDNA library wasconstructed using the SUPERSCRIPTTM Plasmid System and the Not I-Sal I-digested pSPORT 1 vector (Invitrogen). Recombinant pSPORT 1 wasused to transform UltraMaxTM DH5-FT (Invitrogen) for the productionof single-stranded DNA (ssDNA) using the helper phage M13KO7. Bothlibraries were ampliﬁed according to the manufacturers’ protocols beforenormalization.2.3. Production of single-stranded library DNAThe ampliﬁed double-stranded pSPORT 1 library was grown underampicillin selection and converted to single-stranded circles in vivo aftersuper infection with M13K07 as described by (Vieira and Messing, 1987).2.4. PCR ampliﬁcation of biotin-labelled library DNAThe pDNR-LIB library was used as a template for ampliﬁcation ofbiotin-labelled cDNA inserts using the Expand High FidelityPLUS PCRSystem (Roche Diagnostics, Burgess Hill, UK) with the pDNR-LIB and 5′-biotinylated HBX primers (Table 1). Conditions of ampliﬁcation: 94 ◦Cdenaturation for 7min; 30 cycles at 94 ◦C for 1min, 50 ◦C for 2min, 72 ◦Cfor 3min and aﬁnal 7min at 72 ◦C. The PCRproductswere puriﬁed byHighPure PCR Puriﬁcation Kit (Roche) and precipitated with sodium acetateand ethanol before resuspending in 5l of 3′ blocking oligonucleotide(1.5g/l) (Table 1).2.5. Normalization of cDNA libraryNormalization of the pSPORT 1 library was adapted from Bonaldo etal. (1996) and Soares and Bonaldo (1998). A 50ng aliquot of ssDNA wasmixed with 2l biotin-PCR product from the pDNR-LIB library and 15ldeionised formamide. To block hybridization via the common vector andpoly(A) tail sequences, 5′ and 3′ blocking oligonucleotides were designed(Table 1) and included in the hybridization reaction. After the additionof 5l of 5′ blocking oligonucleotides (1.5g/l) and 5l of 3′ blockingoligonucleotides (2g/l) the hybridization mixture was heated to 80 ◦Cfor 3min, followed by the addition of 1.5l of 10× Buffer A (1.2M NaCl,0.1M Tris, pH 8.0 and 50mM EDTA) and 0.5l of nuclease-free water.The reaction mixture was hybridized at 30 ◦C for 24h after which it wasgently mixed with 300l of ice-cold 0.5× SSC (75mM NaCl and 7.5mMsodium citrate) before incubationwith 0.6ml StreptavidinMagneSphere®Paramagnetic Particles (SA-PMPs), washed and prepared as per the man-ufacturer’s instructions (Promega, Southampton, UK). The hybridizationmixture and SA-PMPs were incubated at room temperature for 10min,inverted every 1–2min before the SA-PMPs were captured using a mag-netic stand. The supernatant containing the unhybridized single-strandedcircleswas removed, precipitated at−80 ◦Cwith 5l yeast tRNA (2g/l)by 150l of 7.5M sodium acetate and 600l of ethanol. The ssDNAwas pelleted by centrifugation, washed with ethanol and air-dried beforeresuspension in 11l of nuclease-free water.The ssDNA was converted into dsDNA using SequenaseTM Version 2.0DNA polymerase (USB, Staufen, Germany). The ssDNA was incubated atTable 1Primer and blocking oligonucleotide sequences.Primer Sequence (5′–3′)pDNR-LIB primer ACGAAGTTATCAGTCGACGGTACSP6 primer ATTTAGGTGACACTATA5′-biotinylated HBX primer Biotin-CCAACGAATGGTCTAGAA-AGC3′ blocking oligonucleotide GAAGTTATCAGTCGACGGTACCGGA-CATATGCCCGGGAATTCGGCCATTA-CGGCCGGG5′ blocking oligonucleotide TGGTCTAGAAAGCTTCTCGAGGGC-CGAGGCGGCCGACATGT25M13 reverse primer GGACACACTTTAACAATAGGCGA65 ◦C for 5min with 4l of 5× Sequenase buffer and 1l SP6 primer(1g/l) and then 3min at 37 ◦C, followed by the addition of 1l of DTT(100mM), 2l dNTPs (100mM each) and 1l Sequenase before continu-ing the incubation at 37 ◦C for 30min. The reaction was terminated with80l of 1mMEDTA in 10mMTris (pH8), followed by extractionwith phe-nol:chloroform:isoamyl alcohol (25:24:1) and then chloroform:isoamylalcohol (24:1). The DNA was precipitated at −80 ◦C with 150l of 7Mammoniumacetate, 600l of ethanol and 5l yeast tRNA (10mg/ml). Theprecipitated library DNA was pelleted by centrifugation and resuspendedin 4l of nuclease-free water.A 2l aliquot of library DNA was used to transform ElectroMaxTMDH10BTM T1 phage resistant competent cells (Invitrogen) by electropora-tion and the cells propagated under ampicillin selection to generate thenormalized sheep cDNA library.2.6. Macroarrays: subtractive hybridization of cDNA librariesTo supplement the previously constructed Bovine BrainUnigene Set ofcDNA clones (http://www.imagenes-bio.de/products/sets libraries/) con-sisting of 14,989 unique sequences with unique clones from the sheepcDNA library, subtractivehybridizationwasused to reveal commonclones.Brieﬂy, the normalized sheep library was plated on agar plates underampicillin selection. Single colonies were picked from the agar platesand grown in 384 well plates prior to spotting on four nylon ﬁlters(22 cm×22 cm), with 18,432 colonies per ﬁlter. The ﬁlterswere incubatedwith radiolabelled transcripts prepared from the bovine brain set. Afterhybridization and exposure to phosphorimager plates, colonies from thesheep cDNA library were selected for DNA sequencing. These clones werejudged not to be represented in the bovine brain set by failure of anyradiolabelled probe to hybridize to the sheep library colonies.2.7. DNA sequencingPrior to sequencing, the clones were screened by PCR and agarosegel electrophoresis to ensure the presence of an insert. From the sheepcDNA library, 5000 clones not represented in the bovine set were selectedfor sequencing (MWG, Ebersberg, Germany). Single-pass sequencing wasperformed from the 5′end of the directionally cloned insert using M13reverse primer (Table 1).2.8. Sequence analysisThe chromatogram ﬁles from the sequencing were processed for basecalling by Phred and the raw sequence ﬁles were further processed usingCrossmatch to trim vector sequence, poly(A) tail and low quality basesfromthe sequences (Ewinget al., 1998;EwingandGreen, 1998). Thesepro-grams were implemented within the Trace2dbest software (Parkinson etal., 2004) and used to process the sequence trace ﬁles into quality checkedsequences prior to submission in the dbEST database for ESTs at GenBank(Boguski et al., 1993).The quality EST sequences were further processedwithin Partigene toidentify redundancy and presence of novel sequences by clustering, usingthe Clobb software program (Parkinson et al., 2002). The non-redundantsets of clustered sequences were assembled into consensus sequencesusing Phrap (Ewing et al., 1998; Ewing andGreen, 1998). Preliminary geneannotation was performed using BLASTx (Altschul et al., 1990) with thenon-redundant protein database at the National Center for Biotechnol-ogy Information (NCBI) to provide preliminary gene annotation from theconsensus sequences (Table S1).Functional annotation of the sheep EST sequences based on the GeneOntology (Ashburner et al., 2000) vocabulary was performed using theBlast2GO software suite (Conesa et al., 2005). The GO annotation wasreﬁned using the generic GO Slim mapping and the reduced high-levelGO term annotation is shown in Fig. 2.3. Results and discussionFromthe73,728 sheep clones arrayedon theﬁlters 5000were selected for single-pass sequencing. After processing4052 quality EST sequences (Table S1) were submitted todbEST database, with an average length of 732 base pairsper sequence.Author's personal copyA.G. Gossner, J. Hopkins / Small Ruminant Research 81 (2009) 75–78 77Fig. 1. Clustering results of ovine quality EST sequences using programswithin Partigene, illustrating the overall sequence redundancy of the selected cDNAlibrary.Within the library there were 1449 singletons and themajority of clusters (1880) contained one, two or three ESTs per cluster, conﬁrming successfulnormalization of the library. The remaining 1244 sequences formed 159 unique clusters with 5 or more ESTs per cluster.Fig. 2. Categories of biological processes identiﬁed by gene ontology (GO) mapping. Sheep EST sequences were mapped to numerous biological processesof the hierarchical GO system. These GO annotations were then condensed using the generic GOSlim mapping implemented within the Blast2GO softwaresuite. Biological process terms containing less than 10 sequences were combined and are shown as ‘Others’ within the ﬁgure.Author's personal copy78 A.G. Gossner, J. Hopkins / Small Ruminant Research 81 (2009) 75–78The results of clustering and assembly into consen-sus sequences of the sheep EST sequences are shown inFig. 1. Of the 4052 quality ESTs, 1449 (35.8%) were single-tons and the majority (1359) of the remaining sequencesformed 523 clusters containing 2, 3 or 4 ESTs per cluster.Analysis of BLASTx output for ovine EST data submittedto GenBank indicated that 29% of sequences had a signif-icant (score >300) similarity to sequences in the GenBanknon-redundant protein database.Gene ontology based functional categorization (Fig. 2)showed the sheep EST sequences covered a wide range ofbiological functions.The ovine clones selected from this library will be partof a project used to construct a ∼20,000 non-redundantruminant cDNA microarray chip and used for the analysisof mRNA transcripts in scrapie-infected sheep brains andsecondary lymphoid organs.AcknowledgementsWe thank Dr. J. Foster at Roslin Institute, Neuropatho-genesis Unit, UK for supplying the scrapie tissue samplesfor RNA extraction and R. Talbot at ARK-Genomics for helpwith the macroarrays. We also wish to thank Dr. D. Zhao(Roslin Institute, UK) for his technical advice. Thisworkwassupported by BBSRC grant 15/BS516875.Appendix A. Supplementary dataSupplementary data associated with this article can befound, in the online version, at doi:10.1016/j.smallrumres.2008.11.005.ReferencesAltschul, S.F., Gish, W., Miller, W., Myers, E.W., Lipman, D.J., 1990. Basiclocal alignment search tool. J. Mol. Biol. 215, 403–410.Ashburner, M., Ball, C.A., Blake, J.A., Botstein, D., Butler, H., Cherry, J.M.,Davis, A.P., Dolinski, K., Dwight, S.S., Eppig, J.T., Harris, M.A., Hill, D.P.,Issel-Tarver, L., Kasarskis, A., Lewis, S., Matese, J.C., Richardson, J.E.,Ringwald, M., Rubin, G.M., Sherlock, G., 2000. Gene ontology: tool forthe uniﬁcation of biology. The Gene Ontology Consortium. Nat. Genet.25, 25–29.Barron, R.M., Campbell, S.L., King,D., Bellon, A., Chapman,K.E.,Williamson,R.A., Manson, J.C., 2007. High titers of transmissible spongiformencephalopathy infectivity associated with extremely low levels ofPrPSc in vivo. J. Biol. Chem. 282, 35878–35886.Boguski, M.S., Lowe, T.M., Tolstoshev, C.M., 1993. dbEST—database for“expressed sequence tags”. Nat. Genet. 4, 332–333.Bonaldo, M.F., Lennon, G., Soares, M.B., 1996. Normalization and sub-traction: two approaches to facilitate gene discovery. Genome Res. 6,791–806.Brown, K.L., Stewart, K., Ritchie, D.L., Mabbott, N.A., Williams, A., Fraser,H., Morrison, W.I., Bruce, M.E., 1999. Scrapie replication in lymphoidtissues depends on prion protein-expressing follicular dendritic cells.Nat. Med. 5, 1308–1312.Conesa, A., Gotz, S., Garcia-Gomez, J.M., Terol, J., Talon, M., Robles, M.,2005. Blast2GO: a universal tool for annotation, visualization andanalysis in functional genomics research. Bioinformatics 21, 3674–3676.Ewing, B., Green, P., 1998. Base-calling of automated sequencer tracesusing phred. II. Error probabilities. Genome Res. 8, 186–194.Ewing, B., Hillier, L.,Wendl,M.C., Green, P., 1998. Base-calling of automatedsequencer traces using phred. I. Accuracy assessment. Genome Res. 8,175–185.Parkinson, J., Anthony, A., Wasmuth, J., Schmid, R., Hedley, A., Blaxter,M., 2004. PartiGene—constructingpartial genomes. Bioinformatics 20,1398–1404.Parkinson, J., Guiliano, D.B., Blaxter, M., 2002. Making sense of ESTsequences by CLOBBing them. BMC Bioinform. 3, 31.Prusiner, S.B., 1982.Novel proteinaceous infectious particles cause scrapie.Science 216, 136–144.Riek,R.,Hornemann, S.,Wider,G.,Glockshuber, R.,Wuthrich,K., 1997.NMRcharacterization of the full-length recombinant murine prion protein,mPrP(23-231). FEBS Lett. 413, 282–288.Scott, M.R., Groth, D., Tatzelt, J., Torchia, M., Tremblay, P., Dearmond, S.J.,Prusiner, S.B., 1997. Propagation of prion strains through speciﬁc con-formers of the prion protein. J. Virol. 71, 9032–9044.Soares, M.B., Bonaldo, M.F., 1998. Constructing and screening normalizedcDNA libraries. In: Birren, B., Green, E.D., Klapholz, S., Myers, R.M.,Roskams, J. (Eds.), Genome Analysis: A LaboratoryManual Series. ColdSpring Harbor Laboratory Press, New York, pp. 49–152.Vieira, J., Messing, J., 1987. Production of single-stranded plasmid DNA.Methods Enzymol. 153, 3–11.

Base-calling of automated sequencer traces using phred. II. Error probabilities.

Basic local alignment search tool.

Blast2GO: a universal tool for annotation, visualization and analysis in functional genomics research.

Constructing and screening normalized cDNA libraries. In:

dbEST—database for “expressed sequence tags”.

Gene ontology: tool for the uniﬁcation of biology. The Gene Ontology Consortium.

High titers of transmissible spongiform encephalopathy infectivity associated with extremely low levels of PrPSc in vivo.

Making sense of EST sequences by CLOBBing them.

Normalization and subtraction: two approaches to facilitate gene discovery.

Production of single-stranded plasmid DNA.

Propagation of prion strains through speciﬁc conformers of the prion protein.

Scrapie replication in lymphoid tissues depends on prion protein-expressing follicular dendritic cells.

Incremental generation of an EST set for the analysis of scrapie pathogenesis.

Incremental generation of an EST set for the analysis of scrapie pathogenesis.

Abstract

Similar works

Full text

Available Versions

Edinburgh Research Explorer