Baird, G.D

Entrican, Gary

Logan, M.

McInnes, C. J.

Redmond, J

Nucleic Acids Research

English

PubMed

Edinburgh Research Explorer

     Edinburgh Research Explorer                                      The molecular cloning of the ovine gamma-interferon cDNAusing the polymerase chain reactionCitation for published version:McInnes, CJ, Logan, M, Redmond, J, Entrican, G & Baird, GD 1990, 'The molecular cloning of the ovinegamma-interferon cDNA using the polymerase chain reaction' Nucleic Acids Research, vol 18, no. 13, pp.4012., 10.1093/nar/18.13.4012Digital Object Identifier (DOI):10.1093/nar/18.13.4012Link:Link to publication record in Edinburgh Research ExplorerDocument Version:Publisher final version (usually the publisher pdf)Published In:Nucleic Acids ResearchPublisher Rights Statement:Copyright 1990 Oxford University PressGeneral rightsCopyright for the publications made accessible via the Edinburgh Research Explorer is retained by the author(s)and / or other copyright owners and it is a condition of accessing these publications that users recognise andabide by the legal requirements associated with these rights.Take down policyThe University of Edinburgh has made every reasonable effort to ensure that Edinburgh Research Explorercontent complies with UK legislation. If you believe that the public display of this file breaches copyright pleasecontact openaccess@ed.ac.uk providing details, and we will remove access to the work immediately andinvestigate your claim.Download date: 20. Feb. 20154012 Nucleic Acids Research, Vol. 18, No. 13The molecular cloning of the ovine gamma-interferoncDNA using the polymerase chain reactionC.J.Mcinnes, M.Logan, J.Redmond, G.Entrican and G.D.BairdMoredun Research Institute, 408 Gilmerton Road, Edinburgh EH17 7JH, UKSubmitted May 9, 1990 EMBL accession no. X52640Gamma-interferon (gamma-IFN) is expressed by T cells inresponse to stimulation by antigen or mitogen (1). The ovinegamma-IFN cDNA was cloned by using the polymerase chainreaction to amplify single-stranded cDNA, prepared from mRNAisolated from mesenteric lymph node cells cultured in the presenceof concanavalin A (7.5 lkg/ml) and phorbol 12,13,20-triacetate(5 ng/ml). Specifically a 789 bp fragment of the cDNA wasamplified essentially by the method of Doherty et al. (2), butusing primers corresponding, at the 3' end, to the ovine gamma-IFN gene sequence (McInnes et al. unpublished) and, at the 5'end, to the bovine gamma-IFN cDNA sequence (3). Theamplified fragment was cloned into a plasmid vector and itssequence determined by the chain termination method.The ovine sequence shares approximately 96% homology withthe bovine sequence both at the nucleic acid level and in theirpredicted amino-acid structures. It is also 80% homologous withthe human gamma-IFN sequence at the nucleic acid level and76.5% homologous at the amino-acid level (4).REFERENCES1. Havel,E.A., Spitalny,G.L. and Patel,P.J. (1982) J. Etp. Med. 156, 112-127.2. Doherty,P.J., Huesca-Contreras,M., Dosch,H.M. and Pan,S. (1989)Analytical Biochemistry 177, 7-10.3. Cerretti,D.P., McKereghan,K., Larsen,A., Cosman,D., Gillis,S. andBaker,P.E. (1986) J. Immunol. 136, 4561-4564.4. Devos,R., Cheroutre,H., Taya,Y., Degrave,W., Van Heuverswyn,H. andFiers,W. (1982) Nucl. Acids Res. 10, 2847-2861.M K Y T S S FCCATACACAGGAGCTACCGATTTCAACTACTCCGGCCTAACTCTCTCCTAAMCGATGAAATACACMGCTCCTTC 76L A L L L C V L L G F S G S Y G Q G P F F K E I E NTTAGCTTTACTGCTCTGTGTGCTTTTGGGTTTTTCTGGTTCTTATGGCCAGGGCCCATTTTTTAAAGAAAATAGAAAAC 154L K E Y F N A S N P D V A K G G P L F S E I L K N WTTAAAGGAGTATTTTAATGCAAGTAACCCAGATGTAGCTAAGGGTGGGCCTCTTTTCTCAGAAATTTTGAAGAATTGGK E E S D K K I I Q S Q I V S F Y F K L F E N L K DAAAGAGGAGAGTGACAAAAAGATTATTCAGAGCCAATTGTCTCCTTCTACTTCAAACTCTTTGAAACCTCAAAGATN Q V I Q R S M D I I K Q D M F Q K F L N G S S E KAACCAGGTCATTCAAAGGAGCATGGATATCATCAAGCAAGACATGTTTCAGMGTTCTTGAACGGCAGCTCTGAGAAAL E D F K R L I Q I P V D D L Q I Q R K A I N E L ICTGGAGGACTTCAAAAGGCTGATTCAAATTCCGGTGGATGATCTGCAGATCCAGCGCAAMGCCATCAATGAACTCATCK V M N D L S P K S N L R K R K R S Q N L F R G R RAAGGTGATGAATGACCTGTCGCCAMATCTAACCTCAGAAAGCGGMGAGMGTCAGMTCTCTTTCGAGGCCGGAGA232310388466544A S M *GCATCAATGTAATGGTTCTCCTGCCTGCAATATTTGAATTTTAAAATCTAAATCTATTTATTAATATTTAATATTTTA 62 2CATTATTTATATAGGGAATATATATTTAGACTTATCAAAGTATTTATAATAGTAACTTTTATGTCATGAAAMTGAGTA 700TCTATTMTATATTTGTTATTTATAATTCCTMGACTAACTAGGCAAGTCTATGGATTTCAAGGTTTTATCTCAGGGT 778k.) 1990 Oxford University Press. ... -- -- -_ LJ LJ V VV AJ . o)1.........................CCAACTTGGCA 789

The molecular cloning of the ovine gamma-interferon cDNA using the polymerase chain reaction

http://www.pubmedcentral.nih.gov/articlerender.fcgi?artid=331128

The molecular cloning of the ovine gamma-interferon cDNA using the polymerase chain reaction

Abstract

Similar works

Full text

Available Versions

Edinburgh Research Explorer