Quantitative data produced to support a PhD thesis on the within-host genomic diversity and phenotypic variation of Plasmodium falciparum

Murray, Lee

English

LSHTM Data Compass

 Appendix 2. Primers used in fluorescent parasite generation.     Primer Sequence (5’ to 3’) Purpose LM20FA AATCTAGGTACCAGAATCATATCCTAGGTAATGTTCGTTTTTC Modification of pEFGFP to contain restriction site LM20FB CCTAGGTAATGTTCGTTTTTCTTATTTATATATTTATACCAATTGATTG Modification of pEFGFP to contain  restriction site LM20R AATCTAGGTACCAGAATCATATCCTAGGTAATGTTCGTTTTTC Modification of pEFGFP to contain  restriction site LM24GFPF TTAATATACTAAACGGTACCATGAGTAAAGGAGAAGAACT In-Fusion adapted PCR amplification of GFP LM24GFPR ACGAACATTACCTAGGTTAAGCTGCCATATCCCTCGAC In-Fusion adapted PCR amplification of GFP LM23mCherryF TTAATATACTAAACGGTACCATGGTGAGCAAGGGCGAGGAG In-Fusion adapted PCR amplification of mCherry  LM23mCherryR ACGAACATTACCTAGGACTTACTTGTACAGCTCGTC In-Fusion adapted PCR amplification of mCherry LM22mKateF TTAATATACTAAACGGTACCATGGTGAGCGAGCTGATTAAGG In-Fusion adapted PCR amplification of mKate2 LM27mKateR TATCCCTCGACCCGGGTCATCTGTGCCCCAGTTTGCTAGG In-Fusion adapted PCR amplification of mKate2 A0153 GCACACAACATACACATTTTTACAG Sequencing and colony PCR primer following fluorescent protein ligation.  ST516 CACTTTATGCTTCCGGCTCGTATG Colony PCR amplification of pEFGFPINT. AT1 AACCCTACGTTGGGTGACC Forward wild type and integration P47 PCR amplification  AT2 TGCGATATGTAATTCCATTACTGC Reverse wild type P47 PCR amplification ST509 GGGGCTGGCTTAACTATG Reverse integrated P47 PCR amplification 

Data for: "Investigations into the within-host genomic diversity and

 phenotypic variation of Plasmodium falciparum"

http://datacompass.lshtm.ac.uk/452/2/Thesis_Appendix2.pdf

Data for: "Investigations into the within-host genomic diversity and phenotypic variation of Plasmodium falciparum"

Abstract

Similar works

Full text

Available Versions

LSHTM Data Compass