HIDAYAT,T.; ITO, M.; YUKAWA, T. 2008. The phylogenetic position of thePapuasian genus Sarcochilus R.Br.(Orchidaceae: Aeridinae): evidence from molecular data. Reinwardtia 12(4).281 – 284. –– The taxonomic status of the Papuasian orchid genus Sarcochilus R.Br. remains unresolved. Represented by Sarcochilus chrysanthus Schltr.,a phylogenetic analysis to evaluate relationships between the Papuasian species and those from Australia was conducted using molecular characters.Parsimony analysis using DNA sequences of the internal transcribed spacer (ITS) region showed that this Papuasian species, is in a distant position from the so-called the true Sarcochilus sensu stricto.These results provide additional evidence for the establishment of a new genus Monantochilus

Hidayat, Topik -

Ito, Motomi -

Yukawa, Tomohisa -

REINWARDTIA

English

HIDAYAT, T.; ITO, M.; YUKAWA, T. 2008. The phylogenetic position of the Papuasian genus Sarcochilus R.Br.(Orchidaceae: Aeridinae): evidence from molecular data. Reinwardtia 12(4). 281 – 284. –– The taxonomic status of thePapuasian orchid genus Sarcochilus R.Br. remains unresolved. Represented by Sarcochilus chrysanthus Schltr., aphylogenetic analysis to evaluate relationships between the Papuasian species and those from Australia was conductedusing molecular characters. Parsimony analysis using DNA sequences of the internal transcribed spacer (ITS) regionshowed that this Papuasian species, is in a distant position from the so-called the true Sarcochilus sensu stricto.These results provide additional evidence for the establishment of a new genus Monantochilus

Topik - Hidayat

Motomi - Ito

Tomohisa - Yukawa

Directory of Open Access Journals

The phylogenetic position of the Papuasian genus Sarcochilus R.Br.(Orchidaceae: Aeridinae): evidence from molecular data

E-Journal Portal - Research Center for Biology - Indonesian Institute of Sciences (LIPI) / Pusat Penelitian Biologi - Lembaga Ilmu Pengetahuan Indonesia

LIPIA JOURNAL ON TAXONOMIC BOTANY,PLANT SOCIOLOGY AND ECOLOGY12(4)REINWARDTIAA JOURNAL ON TAXONOMIC BOTANY,PLANT SOCIOLOGY AND ECOLOGYVol. 12(4): 261 - 337, 31 March 2008EditorsELIZABETH A. WIDJAJA, MIEN A. RIFAI, SOEDARSONO RISWAN, JOHANIS P. MOGEACorrespondece on The Reinwardtia journal and subscriptions should be addressed toHERBARIUM BOGORIENSE, BIDANG BOTANI, PUSAT PENELITIAN BIOLOGI - LIPI,BOGOR, INDONESIATHE PHYLOGENETIC POSITION OF THE PAPUASIAN GENUSSARCOCHILUS R.BR. (ORCHIDACEAE: AERIDINAE): EVIDENCE FROMMOLECULAR DATAReceived  August 8, 2007; accepted October 28, 2007.TOPIK HIDAYATDepartment of Biology Education, Faculty of Mathematic and Natural Science Education, Indonesia University ofEducation (UPI), Bandung, Indonesia. topikhidayat@upi.eduMOTOMI ITODepartment of General Systems Sciences, Graduate School of Arts and Sciences, The University of Tokyo, Tokyo,JapanTOMOHISA  YUKAWATsukuba Botanical Garden, National Science Museum, Tsukuba, JapanABSTRACTHIDAYAT, T.; ITO, M.; YUKAWA, T. 2008. The phylogenetic position of the Papuasian genus Sarcochilus R.Br.(Orchidaceae: Aeridinae): evidence from molecular data. Reinwardtia 12(4). 281 –  284. –– The taxonomic status of thePapuasian orchid genus Sarcochilus R.Br. remains unresolved. Represented by Sarcochilus chrysanthus Schltr., aphylogenetic analysis to evaluate relationships between the Papuasian species and those from Australia was conductedusing molecular characters. Parsimony analysis using DNA sequences of the internal transcribed spacer (ITS) regionshowed that this Papuasian species, is in a distant position from the so-called the true Sarcochilus sensu stricto.These results provide additional evidence for the establishment of a new genus Monantochilus.Keywords: ITS  region, Orchidaceae, Papua New Guinea, phylogenetic relationships, Sarcochilus chrysanthusABSTRAKHIDAYAT, T.; ITO, M.; YUKAWA, T. 2008. Posisi filogenetika anggrek Papua marga Sarcochilus (Orchidaceae:Aeridinae): bukti dari data molekuler. Reinwardtia 12(4): 281 – 284. ––  Status taksonomi marga anggrek Sarcochilusyang berasal dari Papua masih belum terselesaikan. Dengan menggunakan Sarcochilus chrysanthus Schltr., analisisfilogenetik untuk mengevaluasi hubungan antara jenis yang berasal dari Papua. dengan jenis yang berasal dari Australiatelah dilakukan menggunakan ciri molekul. Analisis parsimoni dengan menggunakan urutan  DNA dari daerah internaltranscribed spacer (ITS) menunjukkan bahwa jenis yang berasal dari Papua ini sangat berbeda dengan jenis Sarcochilusyang sebenarnya. Hasil ini menyediakan bukti tambahan bagi pembentukan marga baru, yaitu Monantochilus.Kata kunci: Daerah ITS, hubungan filogenetik, Orchidaceae, Papua, Sarcochilus chrysanthusINTRODUCTIONThe orchid genus Sarcochilus R. Br., belongsto the vandaceous subtribe Aeridinae Pfitzer, whichcontains  numerous poorly delimited generaproviding many taxonomic and phylogeneticproblems. Sarcochilus is primarily distributed inAustralia, with only a few species occurring inneighbouring Papua New Guinea. The relationshipbetween the Papuasian species of Sarcochilus andthose of Sarcochilus sensu stricto from mainlandAustralia has long remained unanswered. Rice(2004) separated the Papuasian members ofSarcochilus from the Sarcochilus sensu stricto,placing them into a new genus Monantochilus(Schltr.) R. Rice. This separation was based uponhabit, flower number, labellum mobility, and theexistence of a callus in the spur. However, thesecharacters vary greatly throughout the species.Given the shortcomings of these characters, dataobtained from nucleotide substitutions ofappropriate molecules are preferable in clarifyingthe phylogenetic relationships of this group (e.g.,Moritz  and Hillis 1996).REINWARDTIAVol 12, Part 4, pp: 281 - 284281This study aims to evaluate the phylogeneticrelationships between Papuasian Sarcochilus andSarcochilus sensu stricto at molecular level usingDNA sequences of the internal transcribed spacer(ITS) region. The ITS region has been widely usedby plant systematists because of its small size,highly conserved flanks, high copy number, andrapid concerted evolution (Baldwin et al. 1995).Recently, the ITS region has been used in thephylogenetic analysis in many groups ofOrchidaceae and has provided resolutions forpreviously obscure relationships.MATERIALS AND METHODSSix species of Sarcochilus, viz. the PapuasianS. chrysanthus and five from Australia, wereexamined in this study. Rhinerrhiza was used as anoutgroup, since this genus is recognized as the sistergroup to Sarcochilus based upon morphological andmacromolecular characters (Topik et al. 2005).Specimens were primarily collected from variousregions of Australia, and another obtained fromTsukuba Botanical Garden, Japan. Detailedinformation about plant materials is provided inTable 1.Table 1. Plant materials examined in this studyNotes:AU    :  Specimens were collected in AustraliaTBG : Specimens were collected Tsukuba BotanicalGarden-Japan (TBG).NA     :  Not AvailableThe total DNA was extracted from freshmaterial or silica-gel dried plant tissue with aQIAGEN DNeasy Mini Plant Kit following themanufacturer’s instructions. Amplification,purification, and sequencing of ITS region werecarried out as described in Topik et al. (2005) usinga primer pair, 17SE and 26SE (Fig.1; Sun et al.1994).Nuclear ribosomal DNA17SE= ACGAATTCATGGTCCGGTGAAGTGTTCG26SE= GAATTCCCCGGTTCGCTCGCCGTTACFig. 1. Sequence of ITS region with location of primersused in this study. Information on the primers isalso provided.The DNA sequence obtained from the ITSregion was aligned with Clustal X and was thenadjusted manually following the guidelinesdescribed in Kelchner (2000). Phylogenetic analysisbased on the maximum parsimony criterion wasperformed using PAUP* version 4.0b10 (Swofford1998). Insertions and deletions were treated asmissing data. All characters were equally weightedand unordered (Fitch 1971). Data were analyzed bythe heuristic search method with tree bisection-reconnection (TBR) branch swapping and theMULTREES option on, ten replications of randomaddition sequences with the stepwise additionoption, and all most parsimonious trees (MPTs) weresaved. Evaluation of internal support of clades wasconducted by the bootstrap analysis (Felsenstein1985) utilizing 1,000 replicates with TBR branchswapping and the MULTREES option off. Numberof steps, consistency indices (CI) and retentionindices (RI) were calculated on one of the MPTs ineach analysis with the TREE SCORES commandin PAUP*.RESULTSThe aligned ITS region comprised 662characters. Of these, 547 (83%) were constant and32 (4.8%) were potentially informative. The analysisresulted in one MPT with the length of 153 steps,CI (excluding autapomorphies) of 0.876 and RI of0.548. The strict consensus tree (Fig. 2) showed thatPapuasian Sarcochilus, in this study represented byS. chrysanthus, is separated from Sarcochilus sensustricto. Moreover, monophyly of Sarcochilus fromAustralia is clearly defined, although bootstrap 282                                                                          REINWARDTIA                                                             [VOL.12Taxon Source Voucher  Rhinerrhiza divitiflora (Benth.) Rupp     Sarcochilus hartmannii F. Mueller  Sarcochilus hirticalcar (Dockrill) M.A.   Clem. & B.J. Wallace  Sarcochilus moorei Schltr.  Sarcochilus spathulatus R.S. Rogers  Sarcochilus chrysanthus Schltr.  Sarcochilus weinthalii F.M. Bailey AU TBG AU  AU AU TBG AU NA TBG145793 NA  NA NA TBG145831 NA    ITS region17SE  26 SE NTS    ETS     18S             ITS-1          5-8S     ITS-2                 26S Fig. 2.    Strict consensus tree derived from the parsimonyanalysis of the ITS region of nrDNA. Bootstrappercentages of > 50  are shown above eachbranch.DISCUSSIONFrom global phylogenetic analyses on AeridinaeRegarding the phylogenetic position of thegenus Sarcochilus, a recent global phylogeneticanalysis of subtribe Aeridinae based on DNA (ITSand matK sequences) contributes some information(Topik et al. 2005). In that analysis, Sarcochilus isrepresented by S.chrysanthus and S. hartmannii. Onthis limited basis, Sarcochilus appears to be non-monophyletic. The former makes up Thrixspermumalliance with Thrixspermum, Dimorphorchis,Abdominea, Microsaccus, and Cleisomeria,whereas the latter makes monophyletic withRhinerrhiza and Bogoria. Using much greater taxonsampling of Sarcochilus more robust phylogenetichypotheses for the genus at molecular level couldbe established, as can be seen in this studyGeneric circumscriptionAs mentioned above that, at the molecularlevel, Papuasian Sarcochilus is different fromSarcochilus sensu stricto. In this case, theconsequences were whether to align the Papuasianspecies into the Australian ones, or to split theformer into a new genus. The latter option seemedto be the most practical choice, to avoid Sarcochilusin  becoming non-monophyletic.Schlechter (1913) defined Sarcochilus ratherbroadly subdividing it into three sections basedmainly upon stem length, the number of flowers onthe sessile inflorescences, and lip lobe number;Schlechter’s sections are Monantochilus, Eu-Sarcochilus, and Ascochilus. Rice (2004), however,circumscribed Sarcochilus in a narrower sense,including only species with a short leafy stem andmany-flowered inflorescences. These twomorphological characters are synapomorphic forthe genus (Fig. 2). The result of this analysisdemonstrates wide phylogenetic separationbetween S. chrysanthus and the Australian speciesof Sarcochilus.In comparison with Australian Sarcochilus(section Eu-Sarcochilus), the Papuasian S.chrysanthus has more elongated stems and spurs,and a single-flowered inflorescence. In addition,the presence of a rectangular, flattened callus in adistinct spur, and the absence of a column-foot aredistinctive. The raising of section Monantochilusto a generic rank by Rice (2004)  is supported b ythis study at the molecular level.       Two additional Papuasian species, S. iboensisand S. unifloris, have been transferred toMonantochilus by Rice (2004).Biogeographic overviewIn the past, Papua. was connected withAustralia before finally it was separated  as today(White 1990). Due to its strategic position, Papuasince long time has been acting as a corridor formany groups of plant to migrate from Asia toAustralia, and vice versa. Such pattern of migrationhas been suggested for Nothofagus (Setoguchi etal. 1997), Araucaria (Setoguchi et al. 1999),Amaryllidaceae (Ito et al. 1999), Dendrobium(Yukawa et al. 2000), and Aeridinae (Topik, 2005).We assumed that several members ofSarcochilus have separated at the time of theseparation of Papua from Australia. Consequently,those Papuan species  gradually have to shift theirmorphological features to fit with new conditions.It is natural that migration to a new region may beaccompanied by several morphological changes toadapt to new environmental conditions beforesubsequently they diverge (White 1990).ACKNOWLEDGMENTSThe authors gratefully acknowledge Peter H. Weston,Rod Rice and Mike Harrison for providing most of thematerials used in this study. This study was partlysupported by a Grant-in-Aid for Scientific Research fromJSPS (MI). Jeffrey Wood of the Royal Botanic Gardens,Kew and Kunio Iwatsuki of The University of the Air,Japan kindly read through the manuscript and also MienA. Rifai who kindly did correction of the language.S. hartmanniiS. spathulatusS. hirticalcarS. mooreiS. weinthaliiS. chrysanthusRhinerrhiza divitiflora GenusSarcochilus2008]                                    HIDAYAT et al:: The phylogenetic position of  Sarcochilus                                         28366 99 99 percentages are relatively low (only 66).284                                                                          REINWARDTIA                                                               [VOL.12REFERENCESBALDWIN, B.G., SANDERSON, M.J., PORTER, J.M.,WOJCIECHOWSKI, M.F., CAMPBELL, C.S,DONOGHUE,  M.J. 1995. The ITS region of nuclearribosomal DNA: A valuable source of evidence onAngiosperm phylogeny.  Ann.  Missouri Bot. Gard.82:247-277.FELSENSTEIN, J. 1985. Confidence limit onphylogenies: an approach using the bootstrap.Evolution 39:783-791.FITCH, W.M. 1971. Toward defining the course ofevolution: minimum change for a specific treetopology. Syst. Zool. 20:406-416.ITO M., KAWAMOTO  A, KITA Y., YUKAWA T,KURITA S. 1999. Phylogenetic relationship ofAmaryllidaceae based on matK sequences data. J.Plant Res. 112:207-216.KELCHNER, S.A. 2000. The evolution of noncodingchloroplast DNA and its application in plantsystematics. Ann. Missouri Bot. Gard. 87:482-498.MORITZ, C., HILLIS, D.M.  1996. Molecularsystematics: context and controversies. In: HillisDM, Moritz C, Mable BK [Eds.] MolecularSystematics, 2nd edition, Sinauer Associate,Sunderland, MA, USA, pp 1-13.RICE, R. 2004. A new Vandoid genus for the PapuasianOrchidaceae. OASIS The Journal 3 (Supplement):2-3.SCHLECHTER, R. 1913.  Die Orchidaceen von Deutsch-New-Guinea: Sarcanthinae. Fedde Rep. Beih.1:953-1039.SETOGUCHI, H., ONO, M., DOI, H., TSUDA, M. 1997.Phylogeny and biogeography of Nothofagus basedon the sequences of atpB-rbcL intergenic spacer. J.Plant Res. 110:469-482.SETOGUCHI, H., OSAWA, T.A., PINTAUD, J.C.,JAFFRE T, VEILLON, J.M. 1998. Phylogeneticrelationships within Araucariaceae based on rbcLgene sequences. Am. J. Bot. 85:1507-1516.SUN Y., SKINNER, D.Z., LIANG, G..H., HULBERT,S.H. 1994.  Phylogenetic analysis of Sorghum andrelated taxa using internal transcribed spacers ofnuclear ribosomal DNA. Theor. Appl. Gen. 89:26-32.SWOFFORD, D.L. 1998. PAUP*4.0b10. Phylogeneticanalysis using parsimony (*and other methods).Version 4. Sinauer Associates, Sunderland,Massachussets, USA.TOPIK,  H., YUKAWA., T, ITO, M.  2005. Molecularphylogenetics of subtribe Aeridinae (Orchidaceae):insights from plastid matK and nuclear ribosomalITS sequences. J. Plant. Res. 118:271-284.TOPIK, H. 2005. Systematic study of Subtribe Aeridinae(Orchidaceae). Ph.D. thesis. The University ofTokyo, Japan.WHITE, M.E. 1990. The flowering of Gondwana.Princeton Univ. Press, Princeton.YUKAWA, T., KITA, K., HANDA, T. 2000. DNAphylogeny and morphological diversification ofAustralian Dendrobium (Orchidaceae). In: WilsonKL, Morrison DA [Eds.] Monocots: Systematic andEvolution, CSIRO publishing, Melbourne, Australia,pp 465-471.INSTRUCTION TO AUTHORSManuscripts intended for publication inReinwardtia should be written either in English, Frenchor German, and represent articles wich have not beenpublished in any other journal or proceedings. Eachmanuscript received will be considered and processesfurther if it is accompanied by signed statements givenindependently by two reviewers chosen by the author(s) attestingto its merits as well as its scientificsuitability for publication in Reinwardtia.Two printed copies (on A4 paper) of themanuscript of not more than 200 pages should besent to Editors, together with an electronic copyprepared on Word Processor computer programmeusing Times New Romance letter type and saved asRich Text File must be submitted.For the style of presentation autohrs should followthe latest issue of Reinwardtia very closely. Title ofthe article should be followed by author's name andmailing address and one-paragraphed abstract inEnglish (with French or German abstract for paperin french or German) of not more than 250words.Keywords should be given below eachabstract, on a peparated paper author(s) sholud thepreferred running title of the article submitted.Taxonomic keys should be prepared using thealigned-couplet type.Strict adherence to the International Code ofBotanica Monenclatural is observed, so thattaxonamix and nomenclatural novelties sholud beclearly shown, Latin description for new taxonproposed should be provided, and the herbaria wheretype specimens are deposited should be indicated.Synonyms should be presented in the long form [nameof taxon, author's name, year of publication,abbreviated journal or book title, volume (number):[page].Maps, line drawing illustrations or photographspreferably should be prepared in landscapepresentation to occupy two columns. Illustrationsmust be submitted as original art accompanying, butseparated from the manuscript. On electronic copy,the illistration sholud be saved in .jpg or .gif format.Legends for illustrations must be submitted separatelyat the end of the manuscript.Bibliography, list of literature cited or referencesfollow the Harvard system.For each paper published author(s) will receive25 copies of reprints free og charge, any additionalcopies should be ordered in advance and the author(s)will be charged accordingly.ISSN 0034 365 XREINWARDTIAVol. 12. No. 4. 2008CONTENTSPageJ.F. VELDKAMP. The correct name for the Tetrastigma (Vitaceae) host of Rafflesia (Rqfflesiaeeae) in Malesiaand a (not so) new species ... 261WJ.J.ODE WILDE &B.E.E. DUYFES. Miscellaneous South East Asian cucurbit news 267M.A. RIFAI. Endophragmiella bogoriensis Rifai,spec. nov (Hyphomycetes) 275M.A. RIFAI. Another note on PodoconismegaspemiaBoedijn(Hyphomycetes) 277TOPIK HID A W ; M. ITO; T. YUKAWA. The phylogenetic position of the Papuasian genus Sarcochilus R.Br.(Orchidaceae: Aeridinae): evidence frommolecular data 281C.E. RIDSDALE. Notes on MaiesiznNeonaucleea 285C.E. RIDSDALE. Thorny problems in the Rubiaceae: Benkara, Fagerlindia andOxyceros 289KUSWATAKARTAWINAIA, PURWANINGSIH, T. PARTOMIHARDJO, R. YUSUF, R. ABDULHADI, S.RISWAN. Floristics and structure of a lowland dipterocarp forest at Wanariset Samboja, East Kalimantan,Indonesia 301RUGAiAH & S. SUNARTI. Two new wild species of Averrhoa (Oxalidaceae) from Indonesia 325ATIKRETNOWATI. Anew Javanese species of Marasmius (Trichlomataceae ) 334Reinwardtia is a LEPI acredited Journal (80/Akred-LIPI/P2MBI/5/2007)HERBARIUM BOGORIENSEBIDANG BOTANI ,PUS AT PENELITIAN BIOLOGI - LIPIBOGOR, INDONESIA

THE PHYLOGENETIC POSITION OF THE PAPUASIAN GENUS SARCOCHILUS R.BR. (ORCHIDACEAE: AERIDINAE): EVIDENCE FROM MOLECULAR DATA

https://e-journal.biologi.lipi.go.id/index.php/reinwardtia/article/download/55/59

THE PHYLOGENETIC POSITION OF THE PAPUASIAN GENUS SARCOCHILUS R.BR. (ORCHIDACEAE: AERIDINAE): EVIDENCE FROM MOLECULAR DATA

Abstract

Similar works

Full text

Available Versions

Directory of Open Access Journals

E-Journal Portal - Research Center for Biology - Indonesian Institute of Sciences (LIPI) / Pusat Penelitian Biologi - Lembaga Ilmu Pengetahuan Indonesia