EMTREE drug terms: fungal protein; heat shock protein 90; hybrid protein; transcription factor

EMTREE medical terms: amino terminal sequence; article; carboxy terminal sequence; DNA binding; DNA binding domain; expression vector; Gal4p domain; gene activation; gene activation domain; gene expression; nonhuman; plasmid; plasmid ADC; plasmid BDC; protein domain; protein protein interaction; technique; two hybrid system; yeast

MeSH: Binding Sites; DNA-Binding Proteins; Genetic Vectors; Protein Structure, Tertiary; Recombinant Fusion Proteins; Saccharomyces cerevisiae; Saccharomyces cerevisiae Proteins; Trans-Activation (Genetics); Transcription Factors; Two-Hybrid System Techniqu

Millson, S. H.

Piper, P. W.

Truman, A. W.

University of Lincoln Institutional Repository

BENCHMARKS60 BioTechniques Vol. 35, No. 1 (2003)The yeast two-hybrid system de-tects in vivo protein-protein interac-tions leading to the reconstitution oftranscription factor activity. The DNAbinding domain (DBD) and the activa-tion domain (AD) of this transcriptionfactor are both expressed within thesame cell, but on different fusion pro-teins (the “bait” and “prey” fusions, re-spectively). Active transcription factoris then only reconstituted when theseDBD- and AD-bearing fusions associ-ate noncovalently in the yeast nucleus.The transcription factor activity ismonitored through the reporter genesintegrated in the genomes of the yeastsused for two-hybrid screening (1).The strength of the two-hybrid ap-proach is that it reveals protein-proteininteractions in the context of the livingcell. More confidence can be placed onsuch interaction data if they are knownto involve protein fusions that are stillfunctional—in other words, that neitherthe DBD or AD domain addition northe targeting of the protein fusion to thenucleus has caused loss of functionality.Existing two-hybrid vectors generallyposition the DBD or AD domain at theN-terminus of the protein of interest(1,2). However, there are occasionswhen it is preferable to fuse this domainto the protein’s C terminus (e.g., whenthis allows preservation of the biologi-cal function or provides less self-activa-tion in the two-hybrid system than thecorresponding N-terminal fusion). Tothis end, vectors have been describedfor placing the LexA DBD at the C-ter-minus (3). Here we describe plasmidsthat allow both N-terminal and C-termi-nal fusions to be made with the samevector. These, a slight modification ofthe pOBD2 and pOAD vectors from thelatest development of the Fields two-hybrid system (2), facilitate fusion ofthe Gal4p DBD or Gal4p AD to eitherthe N  or C terminus of any protein ofinterest. This in turn allows rapid iden-tification of which fusion construct ismost suitable for two-hybrid screening.We show an example where positioningthe Gal4p DBD at a protein C terminusgenerates a functional protein fusion,suitable for use in two-hybrid screen-ing, but where the corresponding N-ter-minal DBD addition causes both loss offunctionality and self-activation in thetwo-hybrid system.Vector pBDC (Figure 1) was con-structed by introducing a unique NruIrestriction endonuclease site upstreamof the Gal4p DBD gene in the TRP1vector pOBD2 (2). pBDC is slightlymore versatile than the parent pOBD2in that it can be used to position thisDBD at either the N or C terminus ofany open reading frame (ORF). Gener-ation of N-terminal DBD fusions isthrough in vivo recombination in yeastbetween NcoI plus PvuII-cut pBDC (orpOBD2) and the ORF of interest as alinear fragment [the latter generated bytwo sequential PCR amplifications, us-ing primers with the sequence exten-sions described in an earlier report (2)].Generation of C-terminal DBD fusionsis also through a recombination in yeastbetween linearized pBDC and the ORFas a PCR product, but in this case thepBDC is linearized with NruI (Figure1) and the ORF-encoding DNA is cre-ated using PCR primers with differentsequence extensions. The first PCRused to generate the latter DNA usesprimers that possess 3′ sequence ho-mologies to the ORF of interest, but 5′homologies to the vector [forwardprimer gcttgaagcaagcctcg ATG ****** *** *** *** *** ***; reverseprimer: cagtagcttcatctttcg*** *** ****** *** *** *** (ATG *** ***, etc.,corresponding to the codons of theORF and lowercase letters the se-quences of the pBDC vector)]. Theproduct of this first PCR is then used asthe template in a second round of PCRthat uses primers completely homolo-gous to regions flanking the NruI site ofpBDC (forward primer: caactccaagc-ttgaagcaagcctcgatg; reverse primer:cgatagaagacagtagcttcatctttcg).In a similar way, vector pADC (Fig-ure 1) can be used to position the Gal4AD at either the N or C terminus of anORF. N-terminal AD fusions are gener-ated by an in vivo recombination be-tween NcoI plus PvuII-cut pADC [orpOAD (2)] and the ORF as a linearFigure 1. Vectors pBDC and pADC. These plasmids were derived from pOBD2 and pOAD, respec-tively (2), by changing the pOBD2 sequence at -9 to -4 with respect to the Gal4-DBD initiator codon toTCGCGA and the pOAD sequence at -13 to -8 relative to the Gal4p AD to AAGCTT. Each of these se-quence changes introduced a unique NruI restriction site.Vectors for N- or C-terminal positioning of the yeast Gal4p DNA binding or activator domainsStefan H. Millson, Andrew W. Truman, and Peter W. PiperUniversity College London, London, UKBioTechniques 35:60-64 (July 2003)BENCHMARKSPCR product [generated in two sequen-tial amplifications, using primers withsequence extensions described in anearlier report (2)]. Generation of fu-sions where the AD is positioned at theORF C terminus is through in vivo re-combination between NruI-cut pADC(Figure 1) and an ORF-encoding frag-ment. The latter is again generated bytwo sequential PCR amplifications, thefirst using primers with 3′ sequence ho-mologies to the ORF, but 5′ sequencehomologies to the vector (forwardprimer: agcatacaatccaag ATG *** ****** *** *** *** *** *; reverse primer:cgctttatccatctttgcaaaggc *** *** ****** *** *** *** *). The product of thisfirst reaction is then used as the tem-plate in a second round of PCR, usingprimers homologous to the regionsflanking the pADC NruI site (forwardprimer: caagctataccaagcatacaatccaag-atg; reverse primer: ggaattaattccgctt-tatccatctttgcaaaggc).Figure 2 shows a situation wherepositioning the Gal4p DBD at a proteinN terminus generates a fusion that self-activates in the two-hybrid system andthat has totally lost functionality, butwhere the corresponding C-terminal fu-sion does not self-activate and retainsbiological activity. Heat shock protein90 (Hsp90) is a chaperone essential forthe activity of several key signaling andregulatory proteins in eukaryotic cells.It binds these proteins when they are al-ready substantially folded. Then, in re-sponse to the appropriate activatorysignals, it induces the protein associa-tions that are needed for these “client”proteins to attain full activity (4,5).Placing the Gal4p DBD at the Hsp90 Nterminus produces a fusion that is inca-pable of providing Hsp90 function inyeast (6), probably because this domainaddition interferes with intra- and inter-molecular interactions at the Hsp90 Nterminus that are critical in the Hsp90chaperone cycle (7). On the premisethat a protein fusion that is also a func-tional chaperone would be more likelyto display the true interactions ofHsp90 in the two-hybrid system, we in-vestigated if it might not be preferableto express Hsp90 with a C-terminalDBD extension. The PJ694α Saccha-romyces cerevisiae strain used for two-hybrid screening (2) was transformed,as described above, so that it expressedeither N- or C-terminal Gal4p DBD fu-sions to the major isoform of yeastHsp90 (Hsc82). To determine if thesefusions can confer Hsp90 function, werecovered the TRP1 plasmids that car-ried these DBD-HSC82 and HSC82-DBD fusion genes from the originalPJ694α transformants. We then retrans-formed them into another yeast, a strainthat can be used to test for Hsp90 func-tionality (PP30[pHSC82] (MATa trp1-289, leu2-3,112, his3-200, ura3-52,ade2-101oc, lys2-801am, hsc82::KAN-MX4, hsp82::KANMX4 [pHSC82]) (8).Yeast deleted for both Hsp90 genes isnormally inviable, but strain PP30[pHSC82] is viable because it carriesthe HSC82 gene for Hsc82 on a URA3episomal plasmid (pHSC82). By intro-ducing Hsp90 genes into PP30[pHSC82] on LEU2, TRP1, or HIS3vectors and then selecting for the lossof the original pHSC82 URA3 vector[using medium containing 5-fluo-roorotic acid (FOA), a compound toxicto URA3 gene-bearing cells], it is possi-ble to determine if these introducedgenes can confer the essential Hsp90function. Growth on FOA reveals theintroduced Hsp90 gene is functional,whereas the absence of FOA growthshows it is nonfunctional (8,9). OurpBDC-derived plasmid encodingHsc82 with a C-terminal DBD exten-sion (Hsc82-DBD) could confer suchHsp90 function, whereas the plasmidcoding for Hsc82 with an N-terminalDBD extension (DBD-Hsc82) couldnot (Figure 2a).Expression of the nonfunctionalDBD-Hsc82 fusion also resulted in ap-preciable self-activation in the two-hy-brid system. This was apparent fromthe capacity of this fusion to conferhigh expression of the Gal1p-regulatedHIS3 and LacZ genes in the PJ694αtwo-hybrid strain (2) [evident from thestrong growth in the presence of highlevels of 3-aminotriazole (3-AT; an in-hibitor of the His3p histidine biosyn-thetic pathway enzyme); Figure 2, band c; and high LacZ expression (Fig-ure 2d)]. This high level of self-activa-tion precludes the use of this nonfunc-tional DBD-Hsp82 fusion as “bait” intwo-hybrid screening. In contrast, thefunctional Hsc82-DBD fusion (Figure2a) did not self-activate (growth ofPJ694α containing this construct be-ing inhibited at 0.5 mM 3-AT; Figure2, b and c). However, it was expressedat similar levels to the DBD-Hsc82 fu-sion (Figure 2f). The latter Hsc82-DBD fusion was recently used in astudy of Hsp90’s interactions with anewly discovered Hsp90 system co-chaperone, AhaI (10). PJ694α cellscontaining this fusion have also beenmated to the array of AD-protein fu-sions corresponding to at least80%–90% of the proteins of yeast [ex-pressed in a strain of the opposite mat-ing type, PJ469a (2)]. In the latterscreen, no strong interactors withHsc82-DBD were detected, which isconsistent with the probable transienceof most chaperone interactions. Therewere, however, a number of relativelyweak Hsp90-protein interactions.Many of the latter were to known ac-cessory proteins (co-chaperones) ofthe Hsp90 chaperone system, consis-tent with detection of biologicallymeaningful protein-protein interac-tions (manuscript in preparation).There are probably other instanceswhere, when an N-terminal domain fu-sion is found to self-activate in thetwo-hybrid system, the use of the cor-responding C-terminal fusion willovercome this problem and permit atwo-hybrid screen.ACKNOWLEDGMENTSThis work was supported by BBSRCgrant no. 31/C13023. We are indebtedto Drs. G. Cagney, T. Hazbun, and S.Fields for their kind assistance in set-ting up this project.REFERENCES1.Bartel, P.L. and S. Fields. 1997. The YeastTwo-Hybrid System. Oxford UniversityPress, New York.2.Uetz, P., G. Cagney, D. Lockshon, A.Qureshi-Emili, D. Conover, M. Johnston,and S. Fields. 2000. A protein array forgenomewide screens of protein-protein inter-actions. Nature 403:623-627.3.Beranger, F., S. Aresta, J. de Gunzburg, andJ. Camonis. 1997. Getting more from thetwo-hybrid system: N-terminal fusions toLexA are efficient and sensitive baits for two-hybrid studies. Nucleic Acids Res. 25:2035-2036.4.Pearl, L.H. and C. Prodromou. 2000. Struc-ture and in vivo function of Hsp90. Curr.Opin. Struct. Biol. 10:46-51.5.Picard, D. 2002. Heat-shock protein 90, achaperone for folding and regulation. CellMol. Life Sci. 59:1640-1648.6.Chang, H.C. and S. Lindquist. 1994. Con-servation of Hsp90 macromolecular complex-es in Saccharomyces cerevisiae. J. Biol.Chem. 269:24983-24988.7.Prodromou, C., B. Panaretou, S. Chohan,G. Siligardi, R. O’Brien, J.E. Ladbury,S.M. Roe, P.W. Piper, and L.H. Pearl. 2000.The ATPase cycle of Hsp90 drives a molecu-lar ‘clamp’ via transient dimerization of theN-terminal domains. EMBO J. 19:4383-4392.8.Panaretou, B., C. Prodromou, S.M. Roe, R.O’Brien, J.E. Ladbury, P.W. Piper, andL.H. Pearl. 1998. ATP binding and hydroly-sis are essential to the function of the Hsp90molecular chaperone in vivo. EMBO J.17:4829-4836.9.Piper, P.W., B. Panaretou, S.H. Millson, A.Truman, M. Mollapour, L.H. Pearl, and C.Prodromou. 2003. Yeast is selectively hyper-sensitised to heat shock protein 90 (Hsp90)-targeting drugs with heterologous expressionof the human Hsp90β, a property that can beexploited in screens for new Hsp90 chaperoneinhibitors. Gene 302:165-170.10.Panaretou, B., G. Siligardi, P. Meyer, A.Maloney, J.K. Sullivan, S. Singh, S.H. Mill-son, P.A. Clarke, et al. 2002. Activation ofthe ATPase activity of Hsp90 by AHA1 andother co-chaperones. Mol. Cell 10:1307-1318.Received 19 March 2003; accepted 30April 2003.Address correspondence to Peter Piper, De-partment of Biochemistry and MolecularBiology, University College London, GowerStreet, London WC1E 6BT, UK. e-mail:piper@bsm.bioc.ucl.ac.ukBENCHMARKS64 BioTechniquesFigure 2. Characterization of the consequences of DBD-HSC82 and HSC82-DBD fusion gene ex-pression in yeast. (a) FOA growth of yeast strain PP30[pHSC82] transformed with empty pBDC andpBDC-derived plasmids bearing DBD-HSC82 and HSC82-DBD fusion genes. (b–d) Growth of PJ694αcells bearing the same TRP1 vectors in the presence of the indicated levels of 3-AT. (e) LacZ expressionlevels in the same PJ694α cells. (f) A Western blot probed with an anti-yeast Hsp90 rabbit polyclonalantiserum (9) showing the similar levels of DBD-Hsp82 and Hsp82-DBD expression in these cells (thesignal from the native Hsp90s of these yeasts provides an internal control for equal gel loading).

Vectors for N- or C-terminal positioning of the yeast Gal4p DNA binding or activator domains

Abstract

Similar works

Full text

Available Versions

University of Lincoln Institutional Repository