CDH17 is expressed in human thymic epithelial cells. CDH17 mutations may be a rare cause of leaky severe combined immune deficiency that can be corrected by HSCT

Blazar, BR

Holländer, Georg

Lund, TC

Maio, Stefano

Massaad, MJ

Notarangelo, LD

Rota, Ioanna

Smith, Angela

Blood Advances

English

Key Points
               CDH17 is expressed in human thymic epithelial cells. CDH17 mutations may be a rare cause of leaky severe combined immune deficiency that can be corrected by HSCT.</jats:p

Angela R. Smith

Ioanna A. Rota

Stefano Maio

Michel J. Massaad

Troy C. Lund

Luigi D. Notarangelo

Georg A. Holländer

Bruce R. Blazar

Crossref

Cadherin 17 mutation associated with leaky severe combined immune deficiency is corrected by HSCT

CDH17 is expressed in human thymic epithelial cells.
CDH17 mutations may be a rare cause of leaky severe combined immune deficiency that can be corrected by HSCT.</p

Smith, AR

Rota, IA

Maio, S

Holländer, GA

Oxford University Research Archive (ORA)

Oxford University Research Archive

EXCEPTIONAL CASE REPORTCadherin 17 mutation associated with leaky severe combined immunedeficiency is corrected by HSCTAngela R. Smith,1 Ioanna A. Rota,2 Stefano Maio,2 Michel J. Massaad,3 Troy C. Lund,1 Luigi D. Notarangelo,4 Georg A. Holländer,2 andBruce R. Blazar11Division of Blood and Marrow Transplant, Department of Pediatrics, University of Minnesota, Minneapolis, MN; 2Department of Paediatrics and the Weatherall Institute ofMolecular Medicine, University of Oxford, Oxford, United Kingdom; 3Division of Immunology, Boston Children’s Hospital, Harvard Medical School, Boston, MA; and 4ImmuneDeficiency Genetics Section, Laboratory of Clinical Immunology and Microbiology, National Institute of Allergy and Infectious Diseases, National Institutes of Health, Bethesda, MDKey Points•CDH17 is expressed inhuman thymic epithelialcells.•CDH17 mutations maybe a rare cause of leakysevere combined im-mune deficiency thatcan be corrected byHSCT.IntroductionCadherin 17 (encoded by theCDH17 gene) is a member of the cadherin superfamily encoding calcium-dependent membrane-associated glycoproteins. CDH17 is developmentally regulated and itstranscripts are detected in the fetal but not adult liver and intestines. Somatic CDH17 mutationshave been reported in gastrointestinal malignancies and implicated in tumor progression.1-4 CDH17 isalso expressed in murine precursor and mature B cells,5 where it contributes to their development andmemory B-cell survival.6,7 CDH17 expression has also been demonstrated in mouse thymic medullaryepithelial cells (mTECs), independent of their expression of the autoimmune regulator (AIRE), atranscriptional facilitator of promiscuous gene expression required for correct T-cell repertoire selection.In contrast, CDH17 is barely detectable in cortical TECs.8The consequences of CDH17 mutations for lymphoid development and immune function remain,however, unknown. Here we report on a CDH17-mutated patient with leaky severe combinedimmunodeficiency, who was successfully treated by hematopoietic stem cell transplantation (HSCT),and discuss the possible role of CDH17 mutations in the pathogenesis of the disease.Case descriptionA 5-year-old Saudi Arabian girl presented to us with a long medical history of recurrent sino-pulmonaryinfections and was noted to have severe T- and B-cell lymphopenia with normal natural killer (NK)cellularity. Thymic output (as quantified by T-cell receptor excision circle [TREC] analysis) andaggregate T-cell function were very low (Table 1). The majority of the peripheral T cells had a memoryphenotype, and proliferative response to PHA was low. Tetanus toxoid antibody levels were low. Anextensive workup (see Table 1) failed to determine the molecular cause of the observed lymphopenia.During further workup, a stage 4 EBV-positive DLBCL was diagnosed, consistent with reducedimmune surveillance. After achieving complete remission following 6 cycles of chemotherapy andsurgical resection of tumor tissue in lung and ovaries, the patient underwent myeloablative matchedsibling donor HSCT. A radiation containing regimen was chosen given her DLBCL appeared to beonly partially responsive to chemotherapy as her ovarian disease was discovered shortly aftercompleting her chemotherapy and her lung lesions still contained active disease after 6 cycles ofchemotherapy. Posttransplant, the girl developed grade 2 skin GVHD, CMV viremia/pneumonia, andpulmonary actinomycosis. Remaining in remission from her DLBCL, she had full and stable immunereconstitution by within 2 years following HSCT, and both CD4 and CD8 naı̈ve T-cells, TRECs, T-cellfunction, and immunoglobulin levels returned to normal values (Table 1; Figure 1). Pre-HSCTperipheral blood WES revealed compound heterozygous mutations in CDH17. Each of her parentshad one of the noted and distinct mutations in CDH17 and was healthy with no concern for immunedeficiency.Submitted 16 August 2017; accepted 21 September 2017. DOI 10.1182/bloodadvances.2017010926.24 OCTOBER 2017 x VOLUME 1, NUMBER 23 2083Table1.ClinicalcourseandimmunefunctionBaselineDLBCLdiagnosisWorkupandHSCTDay100post-HSCT1Yearpost-HSCT2Yearspost-HSCTClinicalcourseMultiplelung,sinus,andtonsilinfectionsstartingatage1.5yrequiringfrequenthospitalizationsandantibioticsSCDwithHPFHG6PDDiagnosis:ChestCTwithbilateral,extensivelunginfiltratesLungbiopsyrevealedaDLBCL,EBV12Alevellymphnodes,palatinetonsil,ovaryinvolvedCSFandbonemarrowwerenegativeWorkup(allnegative):HIVPCRFISHforDiGeorgeChromosomebreakagestudiesGrade2skinGVHDtreatedwithtopicalsteroidsonlyCMVviremiaandpossiblepneumoniatreatedwithIVimmunoglobulinandganciclovirPulmonaryactinomycestreatedwithPCNBronchiectasisClinicallywellTreatmentofactinomycescontinuesGeneticworkup(allnegative):Rag1/2ATmutationanalysisNijmegenArtemisXLPXIAPImmunefunctionTcellNumbers(abs):CD35353,CD45118,CD85163Numbers(abs):CD35223,CD45128,CD8592Numbers(abs):CD351350,CD45662,CD85688Numbers(abs):CD351089,CD45633,CD85428TREC(nl.3063):289copies/106CD3TcellsTREC(nl.3063):500copies/106CD3TcellsTREC(nl.3063):3800copies/106CD3TcellsTREC(nl.3063):6010copies/106CD3TcellsProliferation:Lowresponse(,5%ofcontrol)toPHA,absentresponsestocandidaandTTTreatment:Ritux/pred31cycleRitux/pred/MTX/Doxo32cyclesRitux/ARAC/MTX32cyclesRitux/Cy/Vinc/pred/MTX/Doxo32cyclesSurgicalresectionofhilarlymphnodesandlungmassesSurgicalresectionofovaryandperitonealmassWESCompoundheterozygosityforthec.179612T.CmutationandN176SvariantintheCDH17geneHeterozygousvariantintheLIG1geneHomozygousE7VmutationintheHBBgeneHeterozygousS188FmutationintheG6PDgeneProliferation:NormalresponsetoPHA.PWM,candida,andTTnottested.Proliferation:NormalresponsetoPHAandPWM.AbsentresponsestocandidaandTT.Proliferation:NormalresponsetoPHAandPWM.CandidaandTTnottested.TCRdiversity:NormalSubsets(%):Subsets(%):Subsets(%):Subsets(%):T NAIVET CMT EMT EMRACD433.638.726.5 1.19CD84.40.054.8590.7T NAIVET CMT EMT EMRACD4— — — —CD82.852.566 28.7T NAIVET CMT EMT EMRACD4— — — —CD831.7 3.619.545.2T NAIVET CMT EMT EMRACD462.217.118.5 2.13CD839.412.933.713.9BcellNumbers(abs):CD19527Numbers(abs):CD195100Numbers(abs):CD1951058Numbers(abs):CD195756Immunoglobulins*:IgG1270,IgA199,IgM524,IgE,2Immunoglobulins†:IgG494,IgA27,IgM328,IgE,2Immunoglobulins:IgG3180,IgA89,IgM136,IgE4Immunoglobulins:IgG1310,IgA123,IgM124,IgE3Vaccinetiters:TetanusAb0.06(minimallyprotective),diphtheriaAb0.06(minimallyprotective),minimalresponsetoallS.pneumoserotypesResponse:MixedresponsetochemotherapyregimensNEDatthetimeofHSCTHSCTdetails:MSDHSCT(siblinghadnormallymphocytecounts,noSCDorG6PD)Cy/TBI1320cGypreparativeregimenCSA/MTXforGVHDprophylaxisVaccinetiters:TetanusAb0.21(protective),diphtheriaAb0.21(protective),protectiveresponseto9of14S.pneumoserotypes.NKcellNumbers(abs):CD16/565526Numbers(abs):CD16/56572Numbers(abs):CD16/565185Numbers(abs):CD16/565120Activity:NormalActivity:NormalActivity:DecreasedActivity:NormalChimerism100%Donorchimerisminperipheralbloodandbonemarrow100%Donorchimerisminperipheralbloodandbonemarrow100%DonorchimerisminperipheralbloodandbonemarrowAb,antibody;abs,absolute;ARAC,cytarabine;AT,ataxiatelangiectasia;CMV,cytomegalovirus;CSA,cyclosporine;CSF,cerebrospinalfluid;CT,computedtomography;Cy,cytoxan;DLBCL,diffuselargeB-celllymphoma;Doxo,doxorubicin;EBV,Epstein-Barrvirus;FISH,florescenceinsituhybridization;G6PD,glucose6-phosphatedeficiency;GVHD,graft-versus-hostdisease;HBB,bhemoglobin;HPFH,hereditarypersistenceoffetalhemoglobin;MSD,matchedsiblingdonor;MTX,methotrexate;NED,noevidenceofdisease;PCN,penicillin;PCR,polymerasechainreaction;PHA,phytohemagglutinin;pred,prednisone;PWM,pokeweedmitogen;Ritux,rituximab;SCD,sickle-celldisease;TBI,totalbodyirradiation;T CM,centralmemoryTcells;TEM,effectormemoryTcells;TEMRA,effectormemoryTcellsthatexpressCD45RA;TNAIVE,naı̈veTcells;TT,tetanustoxoid;Vinc,vincristine;WES,wholeexomesequencing;XIAP,X-linkedinhibitorofapoptosis;XLP,X-linkedlymphoproliferativedisorder.*PreviousIVimmunoglobulinreplacementtherapyisuncertain.†LastIVimmunoglobulininfusion1monthprior.2084 SMITH et al 24 OCTOBER 2017 x VOLUME 1, NUMBER 2302004006008001000120014001600Baseline Day 100 1 year 2 yearsCells per microliterTime in relation to HSCTBaseline Day 100 1 year 2 yearsTime in relation to HSCTBaseline Day 100 1 year 2 yearsTime in relation to HSCTBaseline Day 100 1 year 2 yearsTime in relation to HSCTBaseline Day 100 1 year 2 yearsTime in relation to HSCTACD3 (nl 700-4200)CD4 (nl 300-2000)CD8 (nl 300-1800)B0102030405060708090100Baseline Day 100 1 year 2 years% of CD8 T cellsTime in relation to HSCTNaiveCentral MemoryEffector MemoryTEMRAC% of CD4 T cells010203040506070 NaïveCentral MemoryEffector MemoryTEMRADTREC copies/10^6 CD3 T cells01000200030004000500060007000TREC (nl >3063)ECells per microliter0200400600800100012001400CD16/56 (nl 90-900)CD19 (nl 200-1600)Fmg/dL0500100015002000250030003500IgG (nl 585-1510)IgA (nl 45-235)IgM (nl 50-230)Gsample: HTH040sorted mTEChi, mTEClo, cTECmTEChimTEClocTEC0.0000.0050.0100.015AIREmRNA expression relativeto b-actinmRNA expression relativeto b-actinmTEChimTEClocTEC0.00000.00010.00020.00030.0004CDH17Figure 1. Immune recovery over time and CDH17 expression in thymic epithelial cells. (A) T-cell numbers. (B) CD8 T-cell subsets. (C) CD4 T-cell subsets. (D) TRECs.(E) B and NK cell numbers. (F) Immunoglobulin levels. (G) CDH17 expression in the human thymus is restricted to the population of mature medullary epithelial cells (mTEChi) as shownby quantitative reverse transcription PCR analysis. mTEChi is a heterogeneous population of thymic epithelial cells that primarily consists of functionally mature, AIRE-expressing cells.24 OCTOBER 2017 x VOLUME 1, NUMBER 23 CDH17 MUTATION ASSOCIATED WITH SCID 2085MethodsPatientThe subject was treated on an institutional review board–approvedHSCT protocol at the University of Minnesota.Human thymus samplesHuman thymus samples were obtained from children undergoingcorrective cardiac surgery at Great Ormond Street Hospital forChildren National Health Service trust after parents’ informed consentand approval by the Great Ormond Street Hospital for ChildrenNational Health Service trust with a Material Transfer Agreement tothe chancellor, masters, and scholars of the University of Oxford.Isolation of thymic epithelial cellsTECs were isolated from the thymic tissue after mechanical andenzymatic tissue disruption followed by magnetic-activated cellsorting and fluorescence-activated cell sorting according to theprotocol published by Stoeckle et al.9RNA extraction and quantitative PCR analysisTotal RNA was extracted from sorted TECs using the RNeasy Mini Kit(Qiagen) according to themanufacturers’ protocol, including in-columnDNase treatment. Complementary DNA was prepared using theSensiFAST kit (Bioline). Complementary DNA was used for quantita-tive PCR with the relevant forward TTTACATTTTCCCTCGGCAGand reverse CCTCAAACTCTGTGTGCCTG primers (Sigma), usingSensifast SYBR Hi-Rox Kit (Bioline) and StepOnePlus (AppliedBiosystems).Flow cytometryStandard flow cytometric methods were used for staining of cell-surface proteins. Anti-human monoclonal antibodies to the follow-ing molecules, with the appropriate isotype-matched controls wereused for staining: CD3 (OKT-3), CD4 (RPA-T4), CD8 (HIT8a),CD19 (HIB19), CD56 (HCD56), CD16 (3G8), CD45RA (HI100),CD45RO (UCHL1), CD31 (390), and CCR7 (4B12), all fromBioLegend (San Diego, CA). Data were collected with anLSRFortessa (BD Biosciences, San Jose, CA), cell analyzer andanalyzed with FlowJo software (Tree Star Inc., Ashland, OR).T-cell proliferationPeripheral blood mononuclear cells were cultured unstimulated orstimulated with 5 mg/mL PHA (Sigma Aldrich; L8754). Proliferationwas assayed 4 days later by measuring 3H-thymidine incorporationinto genomic DNA added for the last 16 hours of culture.Results and discussionHuman TECs interrogated by quantitative reverse transcription PCRshowedCDH17 expression only inmaturemedullary TECs (mTEChi), aheterogeneous population of TECs that primarily but not exclusivelyconsists of functionally mature cells, as molecularly identified by theirexpression of AIRE (Figure 1G). Pre-HSCT peripheral blood WESrevealed compound heterozygous CDH17 mutations (Table 1). Thec.179612 T.C mutation (IVS1312 T.C) in CDH17 abolishes thesplice donor site of intron 13 and is predicted to cause either abnormaltranscripts subjected to nonsense-mediated messenger RNA decay ora protein with abnormal sequence. The c.527A.G mutation (N176S)results in a conservative substitution of one neutral, polar amino acidfor another. Although the molecular and functional consequence ofthis mutation is not yet fully established, it is reported at low frequencyin the ExAC database (minor allele frequency: 0.0001319), with 16heterozygous, but no homozygous subjects carrying this variant.Furthermore, given the thymic expression pattern of CDH17 and therobust donor-derived T-cell recovery post-HSCT, the low thymic outputnoted at initial presentation appeared to the independent of an intrinsicTEC deficiency.Overall, predictions would suggest that the CDH17 mutationsidentified in this child lead in aggregate to altered proteinexpression and/or function though as stated previously, themolecular and functional consequences of these mutations areunknown. At baseline, the patient had a markedly reducednumber of circulating B cells. Because of the role playedby CDH17 on B-cell development and survival, the CDH17mutations may be responsible for B-cell lymphopenia observed inthe patient at baseline. Furthermore, because CDH17 mutationsand loss of expression are associated with malignant tumorprogression, the propensity for EBV lymphoproliferative diseaseprogression to DLBCL may have been supported by CDH17mutations in the malignant B cells. Many primary immunedeficiencies are associated with increased risk for malignanciessecondary to defective immune surveillance and infection withoncogenic viruses. Non-Hodgkin lymphomas, including DLBCL,are among the most common.10In summary, our patient was a compound heterozygote for 2CDH17 mutations without other known immunodeficiency-relatedgenetic mutations, had on presentation severe lymphopenia, anddisplayed significantly abnormal T-cell function. Our investigationsrevealed that CDH17 is also expressed on human mTEChi cells, butbecause T-cell lymphopoiesis was restored post-HSCT in ourpatient, the TEC defect does not appear to be limiting. Based onexperimental data that suggests in the mouse that CDH17mutations cause B-cell defects,5,6 we postulate that the patient’scompound heterozygosity for CDH17 mutations affected bipotentlymphoid progenitors and impaired their differentiation. We thereforeconclude that the compound heterozygous CDH17 mutationsidentified in this patient constitute a rare cause of leaky severecombined immunodeficiency that can be cured with HSCT. Futurestudies delineating the consequences of the patient’s mutations areneeded to confirm this conclusion.AcknowledgmentsThis work was supported by a grant from the National CancerInstitute, National Institutes of Health (P01 CA065493), and by theDivision of Intramural Research, National Institute of Allergy andInfectious Diseases, National Institutes of Health.AuthorshipContribution: A.R.S. wrote the manuscript; L.D.N., G.A.H., and B.R.B.designed the experiments; I.A.R., S.M., and M.J.M. performed the ex-periments andedited themanuscript; andA.R.S., T.C.L., L.D.N.,G.A.H.,and B.R.B. analyzed and/or interpreted the results and edited themanuscript.Conflict-of-interest disclosure: The authors declare no compet-ing financial interests.Correspondence: Angela R. Smith, 420 Delaware St SE; MMC484, Minneapolis, MN 55455; e-mail: smith719@umn.edu.2086 SMITH et al 24 OCTOBER 2017 x VOLUME 1, NUMBER 23References1. Lee NP, Poon RT, Shek FH, Ng IO, Luk JM. Role of cadherin-17 in oncogenesis and potential therapeutic implications in hepatocellular carcinoma.Biochim Biophys Acta. 2010;1806(2):138-145.2. Grötzinger C, Kneifel J, Patschan D, et al. LI-cadherin: a marker of gastric metaplasia and neoplasia. Gut. 2001;49(1):73-81.3. Liu LX, Lee NP, Chan VW, et al. Targeting cadherin-17 inactivates Wnt signaling and inhibits tumor growth in liver carcinoma. Hepatology. 2009;50(5):1453-1463.4. Takamura M, Ichida T, Matsuda Y, et al. Reduced expression of liver-intestine cadherin is associated with progression and lymph node metastasis ofhuman colorectal carcinoma. Cancer Lett. 2004;212(2):253-259.5. Ohnishi K, Shimizu T, Karasuyama H, Melchers F. The identification of a nonclassical cadherin expressed during B cell development and its interactionwith surrogate light chain. J Biol Chem. 2000;275(40):31134-31144.6. Ohnishi K, Melchers F, Shimizu T. Lymphocyte-expressed BILL-cadherin/cadherin-17 contributes to the development of B cells at two stages. Eur JImmunol. 2005;35(3):957-963.7. Funakoshi S, Shimizu T, Numata O, Ato M, Melchers F, Ohnishi K. BILL-cadherin/cadherin-17 contributes to the survival of memory B cells. PLoS One.2015;10(1):e0117566.8. Sansom SN, Shikama-Dorn N, Zhanybekova S, et al. Population and single-cell genomics reveal the Aire dependency, relief from Polycomb silencing, anddistribution of self-antigen expression in thymic epithelia. Genome Res. 2014;24(12):1918-1931.9. Stoeckle C, Rota IA, Tolosa E, Haller C, Melms A, Adamopoulou E. Isolation of myeloid dendritic cells and epithelial cells from human thymus. J Vis Exp.2013;79:e50951.10. van der Werff ten Bosch J, van den Akker M. Genetic predisposition and hematopoietic malignancies in children: Primary immunodeficiency. Eur J MedGenet. 2016;59(12):647-653.24 OCTOBER 2017 x VOLUME 1, NUMBER 23 CDH17 MUTATION ASSOCIATED WITH SCID 2087

https://ora.ox.ac.uk/objects/uuid:85ec0459-3f68-4259-9593-7c31094648f9/files/me300e0f77bdbc0dee70d829dc67d009b

Cadherin 17 mutation associated with leaky severe combined immune deficiency is corrected by HSCT

Abstract

Similar works

Full text

Available Versions

Crossref

Oxford University Research Archive (ORA)

Oxford University Research Archive