Bechi, Paolo

Buccoliero, A. M.

Castiglione, Francesca

Freschi, Giancarlo

Garbini, F.

Gheri, C. F.

Rossi Degl&apos

Taddei, Antonio

Taddei, G. L.

English

Florence Research

Key words: colon adenocarcinoma,immune host response, TCR-gamma.Correspondence to: Francesca Cas-tiglione, Department of HumanPathology and Oncology, University ofFlorence, School of Medicine, Viale GBMorgagni 85, 50134 Florence, Italy. Tel +39-055-4478121;fax +39-055-4379868;e-mail francesca.castiglione@unifi.itReceived June 7, 2007; accepted Sep-tember 7, 2007.TNM staging and T-cell receptor gammaexpression in colon adenocarcinoma. Correlation with disease progression?Francesca Castiglione1, Antonio Taddei2, Anna Maria Buccoliero1,Francesca Garbini1, Chiara Francesca Gheri1, Giancarlo Freschi2, Paolo Bechi2,Duccio Rossi Degl’Innocenti1, and Gian Luigi Taddei11Department of Human Pathology and Oncology, 2Department of Surgical Pathology, University of Florence, School of Medicine, Florence, ItalyABSTRACTAims and background. Colorectal cancer is the second most common cause of can-cer-related death in Europe and the United States. Several studies have evaluated theimmune response to colorectal cancer, with contradictory results. Some studiesshowed that lymphocyte infiltration in colorectal cancer seemed to be an importantprognostic parameter, a finding not confirmed by other studies. Several studiesshowed the gamma-delta T-cell receptor repertoire of intestinal adenocarcinoma. Inthis study, we hypothesize that the presence of T cells with the T-cell receptor gammacomplex may play a particular role in carcinogenesis and tumor progression. Methods. A total of 58 patients with colon adenocarcinoma was included in theanalysis. We used the TNM staging system to grade colon cancer.Results. Thirty samples (52.6%) revealed a polyclonal rearrangement of T-cell recep-tor gamma. In the N0 cases, only 5 samples revealed a T-cell receptor gamma molec-ular assessment; in N1/N2 cases, 25 revealed a T-cell receptor gamma molecular as-sessment. Conclusions. The results showed statistical significance between the presence of T-cell receptor gamma and N1/N2 stage lymph nodes (P = 0.001).IntroductionColorectal cancer is the second most common cause of cancer-related death in Eu-rope and the United States. It is calculated that more than 350,000 new cases are di-agnosed and, in Europe, approximately 200,000 patients die from this disease everyyear1. Mortality rates for colon cancer have decreased during the past 10-15 years,due to the early detection, the more effective screening programs, and because of theadjuvant and neoadjuvant chemotherapeutic treatments that have led to a significantincrease in tumor response and median survival1,2.Several studies have evaluated the immune response to colorectal cancer3-5. Resultsof these studies are contradictory. Some studies have shown that lymphocyte infiltra-tion in colorectal cancer seems to be an important prognostic parameter, but otherstudies did not confirm such findings3-5.Intraepithelial lymphocytes are T cells that reside between the epithelial cells and adistinct cellular compartment. T cells can express different types of the T-cell recep-tor (TCR). The TCR is a heterodimeric receptor that can be formed from two differentpairs of chains: the alpha and beta chains (alpha/beta TCR) or the gamma and deltachains (gamma/delta TCR). In humans, 5-15% of the intraepithelial cells in the smallbowel and up to 40% in the colon express the gamma/delta TCR5-9.Several studies have shown the gamma-delta TCR repertoire of intestinal adenocar-cinoma. They found that most of these T cells rearrange the variable region V‰1 andTumori, 94: 384-388, 2008display two distinct features3-5. The first feature is thattheir TCR repertoire is highly restricted and stable overtime. Thus, despite the theoretical potential for generat-ing an enormous number of different TCR transcripts, aremarkably restricted repertoire is found within the in-testinal T cells. The second feature is that highly com-partmentalized T cells, expressing distinct TCR tran-scripts, were found within different parts of the intes-tine or the peripheral blood. These findings imply afunction that involves local activity of the cell against anarrow repertoire of ligands. This important function ofthe mucosal gamma-delta T-cell population is not com-pletely known10-12.These T cells play an important role in maintaininghost cell integrity. TCR-gamma expression in tumor-in-filtrating lymphocytes is significantly lower than in nor-mal tissue, suggesting T-cell localization in colon tu-mors. Even though tumor cells express antigens that arecapable of activating a host immune response, coloncancers still develop. It has been suggested that an inad-equate T-cell response may in part be responsible forthis phenomenon. Colon cancer cell lines can also pro-duce factors that, in turn, inhibit Tcell function5-9.In the present study, we hypothesized that the pres-ence of T cells with a TCR gamma complex may play aparticular role in carcinogenesis and tumor progres-sion.Patients and methodsCase selectionWe selected tissue blocks of intestinal colon adeno-carcinoma from the archives of the Department of Hu-man Pathology and Oncology of the University of Flo-rence. The specimens were obtained from 58 patientswith known follow-up, all of whom underwent surgicalradical colon resection at the Department of SurgicalPathology of the University of Florence from 2002 to2003. Any suspected lesions are examined with macro-scopic and microscopic evaluation. Thirty-three pa-tients were males and 25 were females, ranging in agefrom 88 to 40 years (mean, 55). Informed consent wasobtained from every patient prior to surgery, and tumorsamples were collected during surgery. All the speci-mens were analyzed by the same pathologist, and pa-tients were divided according to the TNM classification.We compared a group of patients according to TNM N0(Figure 1) to a series of patient N1 and N2 of the pathol-ogy (Figure 2) and evaluated the presence/absence ofgamma-delta TCR in intestinal adenocarcinoma.DNA extraction and genetic analysis of TCR gammaDNA was isolated from formalin-fixed, paraffin-em-bedded tissue sections. After dewaxing and proteinaseK digestion, the DNA was heated to 96°C for 10 min toTCR-GAMMA EXPRESSION IN COLON ADENOCARCINOMA 385destroy proteinase K activity. The DNA was extracted us-ing the “GenomicPrep Cells and Tissue DNA IsolationKit” (GE Healthcare, Buckinghamshire, UK) accordingto the manufacturer’s protocol. DNAs were quantifiedby spectrophotometry and the DNA fragmentation statewas evaluated by 2% agarose gel.The polymerase chain reaction (PCR) assay for TCRγrearrangement was performed with the consensusprimers TVγ (5’-AGGGTTGTGTTGGAATCAGG–3’) andTJγ (5’- CGTCGACAACAAGTGTTGTTCCAC –3’). The as-say is a two-step PCR. The first reactions were carriedout in a volume of 20 µl, with 1.5 mM MgCl2, 0.125 mMdNTPs, 2 pmol of TJγ primer and 1 U Taq polymeraseFigure 1 - Colon adenocarcinoma (hematoxylin-eosin. x10). Thefigure shows a moderately well-differentiated, infiltrating adeno-carcinoma of the colon.Figure 2 - Colon adenocarcinoma (hematoxylin-eosin, x10). Thefigure shows an undifferentiated, infiltrating adenocarcinoma ofthe colon with irregulars glands.(Applied Biosystems, Foster City, CA, USA) with 200-350ng of DNA template. The cycle conditions were: 15 s at94°C, 20 s at 58°C and 20 s at 72°C for 25 cycles.Later on, 20 µl of fresh PCR reagents were added toproducts of first amplification, at concentrations of 1.5mM MgCl2, 0.375 mM dNTPs, 12 pmol of TJγ primer, 18pmol of TVγ primer and 1 U Taq polymerase. The cyclesof this second amplification were 31 with the same pa-rameters of the previous reaction.PCR products were analyzed by 15% acrylamide gelelectrophoresis and visualized under UV illuminationafter ethidium bromide staining. A broad smear can beobtained from a sample with infiltration of polyclonalreactive T cell. Instead, a discrete band suggests thepresence of a monoclonal T-lymphocyte proliferation. APCR not showing smears or bands after polyacrylamidegel electrophoresis means the tissue does not contain Tlymphocytes.Statistical analysisThe presence of TCR gamma/delta T cells in the twogroups of colon carcinoma (correlated with disease pro-gression) was calculated according to the WilcoxonMann-Whitney test. Data analysis was performed usingSPSS Version 11.0 (SPSS, Chicago, IL, USA) statisticalpackage. Fisher’s exact test was applied to statisticalanalysis of amplification’s return. A P value ≤0.05 wasconsidered to be statistically significant.ResultsOverall, 58 patients with colon adenocarcinoma wereincluded in the analysis. We used the TNM staging sys-tem to grade the colon cancer. There were 33 N0 pa-tients, 13 N1 patients and 12 N2 patients. We comparedthe 33 patients with N0 to the 25 patients with N1/N2cancers. The molecular rearrangement of TCR gammawas evaluated. In all cases, DNA extraction was success-ful and the DNA fragmentation state was low. Thirtysamples (52.6%) revealed a polyclonal rearrangement ofTCR gamma (Figure 3). In the N0cases, only 5 samplesrevealed a TCR gamma polyclonal rearrangement; inthe N1/N2 cases, 25 revealed a TCR gamma polyclonalrearrangement (Figure 4). These results show statisticalsignificance between the presence of TCR gamma andN1/N2 stage lymph nodes (P = 0.001). However, therewas no significant correlation between the presence ofTCR gamma, tumor extension and the presence ofmetastasis (P = 0.06).DiscussionChanges in cell surface receptor expression in gas-trointestinal mucosa may play a role in the pathogene-386 F CASTIGLIONE, A TADDEI, AM BUCCOLIERO ET ALsis of colon cancer. Activation of T lymphocytes is initi-ated by binding of the TCR antigen (antigen: OK???).TCR is a multimeric protein complex consisting of adisulfide-linked gamma/delta heterodimer that is non-covalently associated with the CD3 polypeptidic chains.Whereas the alpha and beta proteins contain all of theinformation necessary for antigen recognition, the CD3molecules are responsible for signal transduction. Theimmunoglobulin-like gamma chain, along with thedelta chain, is expressed at the surface of a subset of Tlymphocytes13-15.Two different chain combinations of the TCR complexare used for antigen recognition: TCR alpha/beta andTCR gamma/delta. Gamma/delta cells share numerousfeatures with their alpha and beta counterparts but theyhave several unique properties. Gamma and delta Tcells are more prominent in the skin and gastrointesti-nal mucosa than in peripheral blood and conventionalFigure 3 - Ethidium bromide-stained polyacrylamide gel of PCRproducts from colon adenocarcinoma (lanes 1-7), monoclonalcontrol (cutaneous T cell lymphoma) (lane 9) and polyclonal con-trol (lichen planus) (lane 10). The DNA marker is shown in lane 8.Figure 4 - The graph shows TCR-gamma presence in the differentdisease stages. Five N0 cases (16%) and 25 N1/N2 cases (97%)showed TCR-gamma expression.Presence Absencen.cases302520151050N0 N1/N2lymphoid organs. These T cells play an important role inmaintaining host cell integrity. TCR-gamma expressionin tumor-infiltrating lymphocytes is significantly higherthan in normal intestinal tissue, suggesting T cell local-ization in colon tumors16-18.Even though tumor cells express antigens that are ca-pable of activating a host immune response, colon can-cers still develop. It has been suggested that an inade-quate T-cell response may in part be responsible for thisfeature. Colon cancer cells can also produce factors thatmodulate T-cell function. TCR-gamma/delta cells areselectively and consistently localized in colon tumor tis-sue19,20.We evaluated the expression of TCR gamma in 58 pa-tients with colon adenocarcinoma. The patients weredivided into two groups based on TNM stage: the firstgroup included N0 patients and the second groupN1/N2 patients. We detected TCR gamma in 30 cases(53%). Twenty-one cases were N1 and 4 N2, and only 5cases were N0. We observed that the presence of gam-ma/delta T-cells was significantly correlated with dis-ease progression (P = 0.001). In addition, our study con-firmed that intratumor TCR has a prognostic role in ad-vanced colon carcinoma.We found a significant correlation between the pres-ence of TCR gamma and N1/N2 positive lymph nodes(P = 0.001). The characterization of tumor-specific anti-gens showed that tumors may have antigen determi-nants which are recognized by the immune system. Arecent study indicated that these antigens may be tu-mor-specific peptides that are absent in all adult nor-mal tissues except germline cells. Immunotherapy us-ing adoptive cell transfer is a promising approach whichcan result in the regression of bulky invasive cancer insome patients.As regards colon cancer, some studies have reportedthat some colon carcinoma specimens showed a leuko-cyte infiltrate. In addition, tumor-associated lympho-cytes with polyclonal expansion were demonstrated incolon cancer cell lines. In colon cancer patients, itseems that the clinical outcome may depend on tumorcharacteristics (stage of disease, residual disease, histo-logic type and grade of differentiation) and on the hostresponse to cancer. The manipulation of immunemechanisms may offer powerful therapeutic tools forthe treatment of colon cancer patients. In recent years,several studies have focused on the possible use of Tcells to attack established tumors21,22.In the present study, we observed a significant corre-lation between the presence of TCR gamma and diseasein N1/N2-positive lymph nodes (53%), whereas N0 pa-tients (47%) did not show gamma/delta T cells (P =0.001). This finding (which we have evaluated for thefirst time in the literature) suggests the presence of TCRgamma may have a determinant prognostic role incolon adenocarcinoma treatment. TCR gamma expres-sion is associated with an advanced stage of the pathol-ogy. A recent study showed that gamma/delta T cells, in-volved in inflammatory responses, play a central role intissue damage.Further studies are necessary to better understandthe negative prognostic role of gamma/delta T cells incolon carcinoma. Nevertheless, these data emphasizethe importance of the immune host response to cancerand the need to better study the immune mechanismsin order to modulate therapeutic treatment of cancer.References1. International Agency for Research on Cancer (IARC):Pathology and Genetics of Tumours of the Digestive Sys-tem. In: World Health Organization Classification of Tu-mors, Kleihues P, Sobin LH (Eds), pp. 105-106, IARC press,Lyon, 2000.2. Sheehan KM, O’Connell F, O’Grady A, Conroy RM, LeaderMB, Byrne MF, Murray FE, Kay EW: The relationship be-tween cyclooxygenase-2 expression and characteristics ofmalignant transformation in human colorectal adenomas.Eur J Gastroenterol Hepatol, 16: 619-625, 2004.3. Naito Y, Saito K, Shiiba K, Ohuchi A, Saigenji K, Nagura H,Ohtani H: CD8+ T cells infiltrated within cancer cell nestsas a prognostic factor in human colorectal cancer. CancerRes, 58: 3491-3494, 1998.4. Benhattar J, Delacretaz F, Martin P, Chaubert P, Costa J: Im-proved polymerase chain reaction detection of clonal T-cell lymphoid neoplasms. Diagn Mol Pathol, 4: 108-112,1995.5. Mulder WM, Stukart MJ, de Windt E, Wagstaff J, Scheper RJ,Bloemena E: Mucin-1-related T cell infiltration in colorec-tal carcinoma. Cancer Immunol Immunother, 42: 351-356,1996.6. Dunn GP, Bruce AT, Ikeda H, Old LJ, Schreiber RD: Cancerimmunoediting: from immunosurveillance to tumor es-cape. Nat Immunol, 3: 991-998, 2002.7. Marrogi AJ, Munshi A, Merogi AJ, Ohadike Y, El-Habashi A,Marrogi OL, Freeman SM: Study of tumor infiltrating lym-phocytes and transforming growth factor-beta as prognos-tic factors in breast carcinoma. Int J Cancer, 74: 492-501,1997.8. Nakano O, Sato M, Naito Y, Suzuki K, Orikasa S, Aizawa M,Suzuki Y, Shintaku I, Nagura H, Ohtani H: Proliferative ac-tivity of intratumoral CD8(+) T-lymphocytes as a prognos-tic factor in human renal cell carcinoma: clinicopathologicdemonstration of antitumor immunity. Cancer Res, 61:5132-5136, 2001.9. Benhattar J, Delacretaz F, Martin P, Chaubert P, Costa J: Im-proved polymerase chain reaction detection of clonal T-cell lymphoid neoplasm. Diagn Mol Path, 4: 108-112, 1995.10. Brenner MB, Strominger JL, Krangel MS: The gamma deltaT cell receptor. Adv Immunol, 43: 133-192, 1988.11. Mombaerts P, Arnoldi J, Russ F, Tonegawa S, Kaufmann SH:Different roles of alpha beta and gamma delta T cells in im-munity against an intracellular bacterial pathogen. Nature,365: 53-56, 1993.12. Girardi M, Oppenheim DE, Steele CR, Lewis JM, Glusac E,Filler R, Hobby P, Sutton B, Tigelaar RE, Hayday AC: Regu-lation of cutaneous malignancy by gamma delta T cells.Science, 294: 605-609, 2001.13. Ikeguchi M, Oi K, Hirooka Y, Kaibara N: CD8+ lymphocyteinfiltration and apoptosis in hepatocellular carcinoma. EurJ Surg Oncol, 30: 53-57, 2004.14. Vesalainen S, Lipponen P, Talja M, Syrjanen K: HistologicalTCR-GAMMA EXPRESSION IN COLON ADENOCARCINOMA 387388 F CASTIGLIONE, A TADDEI, AM BUCCOLIERO ET ALgrade, perineural infiltration, tumour-infiltrating lympho-cytes and apoptosis as determinants of long-term progno-sis in prostatic adenocarcinoma. Eur J Cancer, 30A: 1797-1803, 1994.15. Raspollini MR, Castiglione F, Rossi Degl’innocenti D,Amunni G, Villanucci A, Garbini F, Baroni G, Taddei GL: Tu-mour-infiltrating gamma/delta T-lymphocytes are corre-lated with a brief disease-free interval in advanced ovarianserous carcinoma. Ann Oncol, 16: 590-596, 2005. 16. Olive C, Nicol D, Falk MC: Characterisation of gamma deltaT cells in renal cell carcinoma patients by polymerasechain reaction analysis of T cell receptor transcripts. Can-cer Immunol Immunother, 44: 27-34, 1997.17. Spada FM, Grant EP, Peters PJ, Sugita M, Melian A, LeslieDS, Lee HK, van Donselaar E, Hanson DA, Krensky AM,Majdic O, Porcelli SA, Morita CT, Brenner MB: Self-recogni-tion of CD1 by gamma/delta T cells: implications for in-nate immunity. J Exp Med, 191: 937-948, 2000.18. Smyth MJ, Trapani JA: Lymphocyte-mediated immunosur-veillance of epithelial cancers? Trends Immunol, 22: 409-411, 2001.19. McCarthy KP, Sloane JP, Kabarowski JH, Matutes E, Wiede-mann LM: The rapid detection of clonal T-cell prolifera-tions in patients with lymphoid disorders. Am J Pathol, 138:821-828, 1991.20. Van Ravenswaay Claasen HH, Kluin PM, Fleuren GJ: Tumorinfiltrating cells in human cancer. On the possible role ofCD16+ macrophages in antitumor cytotoxicity. Lab Invest,67: 166-174, 1992.21. Santin AD, Hermonat PL, Ravaggi A, Bellone S, Roman JJ,Smith CV, Pecorelli S, Radominska-Pandya A, Cannon MJ,Parham GP: Phenotypic and functional analysis of tumor-infiltrating lymphocytes compared with tumor-associatedlymphocytes from ascitic fluid and peripheral blood lym-phocytes in patients with advanced ovarian cancer. Gy-necol Obstet Invest, 51: 254261, 2001.22. Coulie PG, Karanikas V, Colau D, Lurquin C, Landry C,Marchand M, Dorval T, Brichard V, Boon T: A monoclonalcytolytic T-lymphocyte response observed in a melanomapatient vaccinated with a tumor-specific antigenic peptideencoded by gene MAGE-3. Proc Natl Acad Sci USA, 98:10290-10295, 2001.

TNM staging and T-cell receptor gamma expression in colon adenocarcinoma. Correlation with disease progression?

https://flore.unifi.it/retrieve/handle/2158/359919/187488/2008%20-%20TCR%20e%20TNM%20-%20Tumori.pdf

TNM staging and T-cell receptor gamma expression in colon adenocarcinoma. Correlation with disease progression?

Abstract

Similar works

Full text

Available Versions

Florence Research