Gold, J.R.

Patton, J.C.

Pruett, C.L.

Renshaw, M.A.

Rexroad, C.E., III

Saillant, E.

English

Aquila Digital Community

Gulf of Mexico ScienceVolume 23Number 2 Number 2 Article 112005Microsatellite Markers for Cobia, RachycentroncanadumM.A. RenshawTexas A&M UniversityC.L. PruettTexas A&M UniversityE. SaillantTexas A&M UniversityJ.C. PattonTexas A&M UniversityC.E. Rexroad IIITexas A&M Universityet al.DOI: 10.18785/goms.2302.11Follow this and additional works at: https://aquila.usm.edu/gomsThis Article is brought to you for free and open access by The Aquila Digital Community. It has been accepted for inclusion in Gulf of Mexico Scienceby an authorized editor of The Aquila Digital Community. For more information, please contact Joshua.Cromwell@usm.edu.Recommended CitationRenshaw, M., C. Pruett, E. Saillant, J. Patton, C. Rexroad III and J. Gold. 2005. Microsatellite Markers for Cobia, Rachycentroncanadum. Gulf of Mexico Science 23 (2).Retrieved from https://aquila.usm.edu/goms/vol23/iss2/11SHORT PAPERS AND NOTES Gulf of Mexico Srima, 2005(2), pp. 248-252 0 2003 br the ~farinC" F.mironmental Sdences C'.<JnSortium of Alabama MICROSATELLITE MARKERS FOR COBIA, RACHYCI\NTRON CANADUM.-Polymcrasc chain reaction (PCR) primers are reported for 35 nuclear-encoded microsatcllitcs developed from a genomic library of cobia (Rarhyrentron mnadum). All 35 microsatcllites were tested for reproducibility and polymorphism using 24 co-bia sampled offshore of Ocean Springs, 1·IS. Thirty-three of the microsatellites were found to be polymorphic; genotypes at seven of these differed significantly from Hardy-\Veinberg (H\V) expectations, possibly because of the presence of null alleles. Levels of allele and gene diversity (expected heterozygosity) were luwcr on average than values reported previ-ously for other marine fishes. The 26 micro-satellites whose genotypes were in mv equilib-rium should provide useful tools for future studies of cobia relating to both stock assess-ment and aquaculture. Cobia is a migratory coastal pelagic fish dis-tributed in tropical and subtropical warm wa-ters worldwide except for the eastern Pacific (Shaffer and Nakamura, 1989). The species constitutes an important recreational fishery in the Gulf of :Mexico (Brown-Peterson et al., 2001) and is caught incidentally in the com-mercial fishery (Shaffer and Nakamura, 1989). Interest in cobia aquaculture in the United States has spiked recently because of successes in captive spawning and larval rearing (Dodd, 2001), and it has been suggested (Bridger and Costa-Pierce, 2002) that cobia might be an ide-al species for of(.,hore cage culture. In this note, \Ve report optimized PCR prim-ers for 15 nuclear-encoded microsatellites de-veloped from a cobia genomic library. Briefly, microsatellitcs arc short stretches of nuclear DNA composed primarily of di-, tri-, and tet-ranucleotide repeats inherited in a codomi-nant Uvlcndelian) fashion and distributed throughout euchromatic regions of chromo-somes C'Veber and May, 1989; "reber, 1990; \-Vright and Bentzen, 1994). Microsatcllites also accumulate mutations fairly rapidly (Shug et al., 1 998), making them ideal genetic markers for a variety of applications ranging from stock structure analysis of "wild" populations (Gold and Turner, 2002; Zatcoff et al., 2004) to par-entage assignment and pedigree reconstruc-tion in domesticated populations (Wilson and Ferguson, 2002; Jones and Arden, 2003). In-eluded in this note are summary data for 20 other microsatellitcs for cobia developed in our laboratory by Pruett et al. (2005). The summary data for all 35 microsatellites include number and size of alleles detected, observed and expected heterozygosity, and results of tests of conformity to Hardy-\Veinberg equilib--rium expectations at each microsatellite. The summary data are published here to allow con-venient access to all PCR primers and other data. Details regarding genomic library construc-tion, ligation of size-selected (500-2,000 base pairs) fragments into cloning vectors and transformation into competent Esche1ichia coli cells can be found in Pruett et al. (2005). A total of 19,200 clones were hybridized with cocktails of oligonucleotide probes, and 164 positive clones were sequenced. A total of 5•1 clones containing microsatellite motifs were identified: 45 primer pairs 'ivere designed from sequences flanking the microsatellites with the programs Amplify 1.2 (Engels, 1993) and Net-primer (http:/ /w'ivw.premierbiosoft.com/ netprimer). Optimization of PCR protocols was carried out on DNA from eight individuals. PCR amplifications were performed in 1 0-J.d reaction volumes, consisting of 1 JJ..l ( ~25 ng) of DNA, 1 1-11 of lOX reaction buffer (500 mM KCI, 100 mM Tris, 10% Triton-X 100), 0.1 U of Taq DNA polymerase (GibcoBRL), 0.5 !J-M of each primer, 200 1-1~'1 of each dNTP, and 1 mlvl J\JgCl2• PCR conditions consisted of an ini-tial denaturation of 94 C for 3 min, followed by 30 cycles of denaturation at 94 C for 30 sec, annealing at optimized temperature (Table 1) for 45 sec, extension at 72 C for 1 min, and a final extension at 72 C for 10 min. The primer-pair sequences (forward on top, reverse on bottom), microsatellite motifs (re-peat sequence), size of cloned alleles, and op-timized annealing temperatures (ATs) arc giy-en in Table 1. The suite of 35 microsatellites includes 26 di-, one tri-, and four tctranucleo-tide repeat motifs; four of the microsatellites contain complex repeats (i.e., a combination of different repeat motifs). Genotypes for all 35 microsatellites were acquired from 24 cobia sampled offshore of Ocean Springs, J\JS. The number of assayed individuals (N), the num-ber of alleles (A:-;-), and the range in size of detected alleles for each microsatellite also are given in Table 1. Thirty-three of the microsat-ellites were found to be polymorphic; the av-1Renshaw et al.: Microsatellite Markers for Cobia, Rachycentron canadumPublished by The Aquila Digital Community, 2005TABLE 1. Summary data for 35 microsatellites developed from a cobia (Rachycentron canadum) genomic library. PCR primer sequences are forward (top) and reverse (bottom). Primers Rca 1 B-E08A and Rca 1B-E08B were developed from a single clone. Sequences of clones are listed under GenBank accession numbers AY721664-AY721682 and AY850008-AY850022. Significant deviations from Hardy-Weinberg expected proportions are in bold. Size of Range in Repeat sequence of cloned allele allele size Microsatellite PCR primer sequences (5' ~ 3') cloned allele (base pairs) AT N AN (base pairs) H 0/HE PI-IW Rca lB-AlO GCAGCCCAATGCTAACAAGCC (GTT) 6 180 60 24 6 169-187 0.417/0.723 0.000 CATGTAGTCAAGCGAGCCACG Rca 1B-C06 CCAGCATATCTCCTCTCAAGA (GATA) 29 346 50 23 13 340-404 0.870/0.904 0.370 GGCTTGAACTTAACTACAGCTCCT Rca 1B-D09 CAGCCTGCTTAGCCTATCA (GT) 9 (CTGTh(CTh(GT) 2 167 60 23 1 168 0.000/0.000 1.000 GAAGGATGGACCACTTGTGAC Rca IB-DIO GCAACTGCCTCCACCAATCA (CTAT) 15 191 50 24 17 143-223 1.000/0.943 0.597 CATGTGCATCGAAAGACAGAGA C/J Rca 1B-E02 GTGTTGCAGCCAAATGCTA (CTlJ8 308 60 24 7 297-313 0.667/0.598 0.503 :I: CTCCCTAGTGCCACTACAGCTC 0 Rca IB-E06 GGATCAGTGTGTTGCAGCCA (TC) 18 314 45 24 8 305-327 0.625/0.695 0.000 ~ CCCTAGTGCCACTACAGCTCCCT ~ Rca 1B-E08A CATATCAAGTCAATATCACAGACC (CA) 3GA(CA),A(CA) 16 227 55 24 5 181-225 0.458/0.582 0.028 CCACGGAATAGCAGACTTTCTC trl :::0 Rca 1B-E08B GCAGTTGATTCTGATTGCTACAC (CA) 8GA(CAh 122 60 24 2 121-123 0.458/0.510 0.692 C/J CTAATGCCAGCTCATTATGTCC ~ Rca 1B-F06 CAAGCAAATGCGTGGCCGA (CTATlJ5 268 55 24 11 260-300 0.542/0.796 0.000 u CGTTAGCAACCACACGAGCTTG z Rca 1B-F07 GGAATCTGGTGGTGAGTCAT (GACA) 6(CAl12 140 55 24 3 131-139 0.083/0.082 1.000 0 CTGTGGCTGAAGCGTGTGTT ,__, Rca 1B-G10 GGAAACTCTATAACAGCATGTC (CT)sTT(CT) 4 154 55 23 2 153-155 0.043/0.043 1.000 trl C/J GTAGACAGAGCAACACATGAG Rca 1-H09 CATGTTATTCTCCAACTCATGG (GATAlsJ 220 48 23 12 176-224 0.957/0.910 0.343 GTGTATCCGCATACTTTCAG Rca 1-A04 CACGCACATGCACTACTTTAACC (CA) 9 (CACT) 4 202 60 24 6 196-206 0.625/0.722 0.107 GCTGTTGATGTGGCGAAGCAAC Rca l-AOS GGATCATAAGGGATTGTGCTA ( GT) 13GCAT ( GT) 5 289 48 24 8 287-321 0.208/0.575 0.000 CCTCGAGCCATATCATCAT Rca 1-All CTACAGTGGTGTTCCCTGTTAG (GTh4 187 55 24 15 167-201 0. 792/0.889 0.265 CAGTACATAGAGAAACAGGAGG Rca 1-B12 GCTTCAGGCAAGTGAGACC (AC) 9 181 55 24 9 176-196 0.500/0.808 0.000 GGGAGGTAATTATGTCCTGT Rca 1-C04 GACATCAAGTGGCACTTTG (GTlJ7 219 48 24 10 223-253 0.667/0.641 0.185 ~ CACTAAACTTGTTCCTCCTG ,.,_ <.0 2Gulf of Mexico Science, Vol. 23 [2005], No. 2, Art. 11https://aquila.usm.edu/goms/vol23/iss2/11DOI: 10.18785/goms.2302.11TABLE 1. Continued. Nl (J1 Size of Range in 0 Repeat sequence of cloned allele allele size Microsatellite PCR primer sequences (5' ---7 3') cloned allele (base pairs) AT N AN (base pairs) HofHE pHW Rca 1-D04 GCTGAACTTGTCGCCGCT (TG)gAC(TG) 5 127 60 24 3 125-129 0.667/0.551 0.733 GGACTGAACCTCCCTATCCTC Rca 1-D07 CCATGGCTACAATCTGGTTCATC (GT) 9TTT(GT)s 157 60 23 4 154-162 0.130/0.128 1.000 CGAATGCTGTGGAGAACAGG Rca 1-D08 GCTTGACTCCAGCTCAAAC (CAho 172 55 23 4 172-178 0.261/0.274 0.074 CACAAGGACGAGCCTCCA 0 Rca 1-D11 CGTAACACCTTTGGAAGACATC (GT) 8 208 55 24 4 204-212 0.333/0.295 1.000 c CTCCATTGAGGCTGACTAGTG t-< >Tj Rca 1-E04 CCAAGAACAGGCGGGCAAC ( CA) 88bp ( CA) 5 220 55 23 4 215-237 0.391/0.336 1.000 0 GCCACCATTGTGTGTGGGTGA >Tj Rca 1-E05 GCAGTCGAGACGTGACTGAACGA (CA) 20 ( CGCA) 4 ( CA) 7 (CGCA) 4 248 55 24 8 241-259 0.542/0.768 0.000 ~ CGTGGAGCTGCTCTGCAGGA tTl X Rca 1-E06 GGCACCAATCACTCACTACTG (CA)sg 180 48 24 9 144-186 0.458/0.826 0.000 ....... (") TGTTGAGGTCTATCAGTGCC 0 Rca 1-E11 GTCCCAGCTCCAGCCCAAAC (CA)12 173 55 23 7 167-181 0.783/0.757 0.236 CFl GACACTGGCTGCGTGAGCA (") H Rca 1-F01 GCTCATTTCACTAAGTGTGTTGTAGC (TG)r2 198 60 24 2 201-205 0.125/0.120 1.000 tTl z CCATGAATCTACATTCACCTGCCA (") Rca 1-F07 GCATCGGGTTGAGTTGTACT (CA) 6CG(CA)s 235 60 23 1 235 0.000/0.000 1.000 _tTl CGTTGCCTGTCAATCTGTGCT Nl Rca 1-F10 CCGTTCTGTACAGACGTGAAC ( CAhCG( CA) 12CG( CA) 4 287 55 23 5 287-297 0.261/0.423 0.004 0 0 GCCTGTTGCTGTTTCCTGTCA (J1 Rca 1-F11 GTTGCCATGGCGACCGAGA (GA) 8AA(GA) 5 122 55 24 2 119-121 0.000/0.082 0.022 a GCCCCTATGTCTCGTTCCATC ~ Rca 1-G02 GGGACCATGTGAACTCATGCT (GT)14 238 60 23 2 240-244 0.043/0.043 1.000 Nl CCAGACATGGACTGGTACACCT (.)0 ~ Rca 1-G05 GGGCTGTCTGCTGGCTGTAA (GT) 17 280 60 24 5 275-283 0.667/0.651 0.185 Nl ~ GCATCTGTGTCCTGGTGAGAGTC Rca 1-H01 GTCCC~~GGGAATAGCGAAG (CA)s, 298 48 23 12 275-311 0.826/0.885 0.129 CCTCCAGACCAGACAGCAGA Rca 1-H04A GGGAGCCATGTGGTACAGACT (GT) 18 161 60 24 3 156-162 0.667/0.550 0.269 GGGCTTTACGAAAGATAGCTGA Rca 1-HOS GAGACCTACATGGCAGAAGGT (GT)s0 278 60 24 9 273-299 0.708/0.696 0.984 GACCACTCCTTTGAGGTCTCT Rca 1-H10 GCACCGCACTGCACAACAC (CA)r5 121 60 24 8 119-139 0.583/0.777 0.145 GCTGTGCATACTCACACTGCT 3Renshaw et al.: Microsatellite Markers for Cobia, Rachycentron canadumPublished by The Aquila Digital Community, 2005SHORT PAPERS AND NOTES 251 erage number of alleles per polymorphic mi-crosatellites was 7.1 (range 2-17). Estimates of observed (H0 ) and expected (HE) heterozy-gosity were computed with the Genetic Data Analysis (GDA) program (Lewis and Zaykin, 2001) and are given in Table 1. For the poly-morphic microsatellites, average observed het-erozygosity was 0.496 (range 0.000-1.000), whereas the average expected heterozygosity was 0.563 (range 0.043-0.943). The average nmnber of alleles and average expected het-erozygosity (also called gene diversity) per mi-crosatellite are lower than averages reported previously by DeWoody and Avise (2000) for several species of marine fishes. Probabilities of departure from Hardy-Weinberg equilibrium expectations (Pmv) were computed by exact tests, as implemented in GDA (Lewis and Zay-kin, 2001) and are given in Table 1. Genotypes at seven of the microsatellites differed signifi-cantly from Hardy-Weinberg equilibrium ex-pectations following (sequential) Bonferroni correction for multiple tests performed simul-taneously (Rice, 1989). Results of analysis by Microchecker (Van Oosterhout et al., 2004) in-clicated that six of these seven microsatellites (all but Rca 1B-E06) had a general excess of homozygotes for most allele size classes, sug-gesting the presence of null alleles. The 26 mi-crosatellites whose genotypes were in HW equi-librium should prove extremely useful in fu-ture studies of cobia relating to both stock as-sessment and aquaculture. The use of microsatellites as selectively neutral genetic markers to assess geographic boundaries and genetic diversity of "wild" stocks is well re-viewed in \~\~"right and Bentzen (1994) and Car-valho and Hauser (1995); the use of microsat-ellites in aquaculture includes parentage as-signment, pedigree reconstruction, mapping of quantitative trait loci, and marker-assisted selection and is well reviewed in Liu and Cor-des (2004). Achnowledgments.-We thank]. Franks of the Gulf Coast Research Laboratory and]. Graves of the Virginia Institute of Marine Science for assistance in obtaining samples and C. Brad-field and P. Berry for technical assistance in the laboratory. Work was supported by the Sal-tonstall-Kennedy Program of the U.S. Depart-ment of Commerce (grant NA17FD2371) and by the Texas Agricultural Experiment Station (Project H-6703). We thank Blackwell Publish-ing for permission to use material in the pub-lication authored by Pruett et al. (2005). This paper is number 45 in the series "Genetic Studies in Marine Fishes" and Contribution 132 of the Center for Biosystematics and Bio-diversity at Texas A&M University. LITERATURE CITED BRIDGER, C. J., AND B. A. COSTA-PIERCE. 2002. Sustain-able development of offshore aquaculture in the Gulf of Mexico. Gulf Carib. Fish. Inst. 53:255-265. BROWN-PETERSON, N. J., R. M. OVERSTREET, J. M. LOTZ,J. S. FRANKS, AND K. M. BURNS. 2001. Repro-ductive biology of cobia, Rachycentron canadum, from coastal waters of the southern United States. Fish. Bull. 99:15-28. CARVALHO, G. R., Ai'ID L. HAUSER. 1995. Molecular genetics and the stock concept in fisheries, p. 55-79. In: Molecular genetics in fisheries. G. R. Car-valho and T.J. Pitcher (eds.). Chapman and Hall, London. DEWOODY, J. A., MTD J. C. A VISE. 2000. Microsatellite variation in marine, freshwater, and anadromous fishes compared with other animals. J. Fish. Bioi. 56:461-473. Donn, Q. 2001. US cobia culture meets early success. Hatch. Int. 2:14--17. ENGELS, 'vV. R. 1993. Contributing software to the in-ternet: the Amplify program. Trends Biochem. sc'i. 18:448-450. GOLD, J. R., Ai'ID T. F. TURNER. 2002. Population structure of red drum ( SciaenojJs ocellatus) in the northern Gulf of lVIexico, as inferred from varia-tion in nuclear-encoded microsatellites. Mar. Bioi. 140:249-265. JoNES, A. G., AND W. R. ARDEN. 2003. Methods of parentage analysis in natural populations. Mol. Ecol. 12:2511-2523. LEvi'IS, P. 0., Ai'ID D. D. ZA\1UN. 2001. Genetic Data Analysis ( GDA): computer program for the anal-ysis of allelic data. Vers. 1.0 (d16c). Available at http:/ /lewis.eeb.uconn.edu/lewishome/ software.html. Lru, Z. J.,and J. F. Cordes. 2004. DNA marker tech-nologies and their applications in aquaculture ge-netics. Aquaculture 238:1-37. PRUETT, C. L., E. SAJLIANT, M.A. RENSHAW,J. C. PAT-TON, C. E. REXROAD III, Ai'ID J. R. GOLD. 2005. Mi-crosatellite DNA markers for parentage assign-ment and population-genetic studies in cobia, Ra-chycenlron canadum. Mol. Ecol. Notes 5:84--86. RrcE, W. R. 1989. Analyzing tables of statistical tests. Evolution 43:223-225. SHAI'FER, R. V., AND E. L. NAKAMURA. 1989. Synopsis of biological data on the cobia Rachycentron can-adum (Pisces: Rachycentriclac). U.S. Department of Commerce, NOAA Technical Report NMFS 82, FAO Fisheries Synopsis 153, Rome, Italy. SHUG, M. D., C. M. HUTTER, K. A. WETTERSTRAND, M. S. GAUDETTE, T. F. C. MACKAY, AND C. F. AQUADRO. 1998. The mutations rates of di-, tri-, and tetra-nucleotide repeats in DrosojJhila melanogaste1: Mol. Bioi. Evol. 15:1751-1760. VAN OosTERHOUT, C., W. F. HUTCHINSON, D. P. M. WILLIS, AND P. SHIPLEY. 2004. Micro-Checker: soft-ware for identifYing and correcting genotyping er-4Gulf of Mexico Science, Vol. 23 [2005], No. 2, Art. 11https://aquila.usm.edu/goms/vol23/iss2/11DOI: 10.18785/goms.2302.11252 GULF OF MEXICO SCIENCE, 2005, VOL. 23(2) rors in microsatellite data. Mol. Ecol Notes 4:535-538. WEBER, J. L. 1990. Informativeness of human (dC dA)n (dG dT)n polymorphisms. Genomics 7:524-530. ---,AND P. E. MAY. 1989. Abundant class of 1m-man DNA polymm·phisms which can be typed us-ing the polymerase chain reaction. Am. J. Hum. Genet. 44:388-396. WILSON, A. J., AND M. M. FERGUSON. 2002. Molecular pedigree analysis in natural populations of fishes: approaches, applications, and practical consider-ations. Can. J. Fish. Aquat. Sci. 59:1696-1707. WRIGHT, A. J., AND P. BENTZEN. 1994. Microsatel!ites: genetic markers for the future. Rev. Fish Bioi. Fish. 4:384-388. ZATCOFF, M. S., A. 0. BALL, AND G. R. SEDBERRY. 2004. Population genetic analysis of red grouper, EjJine-jJhelus moria, and scamp, lviycteroperca jJhenax, from the southeastern U.S. Atlantic and Gulf of Mexico. Mm: Bioi. 144:769-777. M. A. RENSHAW, C. L. PRUETT, E. SAILLANT, j. C. PATTON, C. E. REXROAD III, AND ]. R. GoLD, Center for Biosystematics and Biodiversit)', Department of Wildlife and Fisheries Sciences, Tex-as A&M University, College Station, Texas 77843-2258. May 11, 2005. 5Renshaw et al.: Microsatellite Markers for Cobia, Rachycentron canadumPublished by The Aquila Digital Community, 2005

Microsatellite Markers for Cobia, Rachycentron canadum

https://aquila.usm.edu/cgi/viewcontent.cgi?article=1451&amp;context=goms

Microsatellite Markers for Cobia, Rachycentron canadum

Abstract

Similar works

Full text

Available Versions

Aquila Digital Community