In order to study the epidemiologic relationship between children's
papillomaviral disease and papillomaviral infection of mothers, five anogenital warts
and seven laryngeal papilloma in children were analyzed by polymerase chain reaction
to detect HPV DNA HPV type 6 was found in 8 cases and HPV type 11 in 7 cases.
Both types were found in 3 cases. From these results, anogenital warts and laryngeal
papilloma in children are found to be pure viral diseases caused by HPV type 6 and 11.
Nine cases of DNA extracted from cervical swabs from mothers of children with
condyloma or laryngeal papilloma, were examined to identify possible latent infection
of HPV. Among 9 cases, HPV DNA was found in two cases. These results suggest that
inapparent infection of HPV type 6, 11 in the birth canal may contribute to the development
of these viral diseases in their offspring aside from sexual abuse

Jung, Seung Yong

Kim, Kwang Hyun

Lee, Yong Suk

Oh, Jun Kyu

Park, Kyoung Chan

SNU Open Repository and Archive

Tlie S ~ o u l  Jourwrrl of Mc~Oicir~r Vol. 34, No. 4:  31 1-314, Dec.clrnhc~r 1993 Detection of Human Pap i l l omav i rus (H~~)  DNA in Children's Genital and Respiratory Tract Papilloma and in Birth Canals of Their  others sf Seung Yong Jung, Jun Kyu Oh, Yong Suk Lee, Kyoung Chan Park' and Kwang Hyun Kim2 Dty~1rtn1~~11t.s of D ~ ~ Y I I ? N I O / O ~ I '  (rt~d I O I C I ~ : I ' I I ~ O I O ~ I ~ ,  C O / / C ~ C  ( j f  Merlic,it~e, Seoul N~tiorlrrl L/nivcr-sit~, . Sro~il 110- 744. Korc~r = Abstract = In order to study the epidemiologic relationship between children's papillomaviral disease and papillomaviral infection of mothers, five anogenital warts and seven laryngeal papilloma in children were analyzed by polymerase chain reaction to detect HPV DNA HPV type 6 was found in 8 cases and HPV type 11 in 7 cases. Both types were found in 3 cases. From these results, anogenital warts and laryngeal papilloma in children are found to be pure viral diseases caused by HPV type 6 and 11. Nine cases of DNA extracted from cervical swabs from mothers of children with condyloma or laryngeal papilloma, were examined to identify possible latent infection of HPV. Among 9 cases, HPV DNA was found in two cases. These results suggest that inapparent infection of HPV type 6, 11 in the birth canal may contribute to the develop- ment of these viral diseases in their offspring aside from sexual abuse. Key Words: Hi!nllrn P~rpillot~lrr~~ir.~r.v, Poll3t?lc~r.~r.rc rhoit1 r.c~lrc.tion, C O ~ Z L / ~ ~ / ~ I I I N  u c u ~ ~ l i t ~ u t u n l ,  Lu- ri.ngcl11 ~ ~ u p i l l o ~ ~ ~ ~ r  INTRODUCTION Condyloma acuminatum(Fig. 1 )  occurs in the genital area by infection of human papillomavirus(HPV), ma~nly  type 6, 11 and oc- casionally type 16, 18(0r1el 1987; Gross et at. 1985). Laryngeal papilloma is the most com- mon benign tumor in the larynx. But its cause had not been established until Gissman et a/. This \w,rk mas supported hy a granl  Sroni Sc,oul Fig. 1 .  Perlanal cond~lorna acuminatum NC1t ional Unii.ersity Hospital Rescarch Fund(  1993 1 .  ' Author fo1- corr-cspo~iilence (1983) demonstrated HPV from a laryngeal pap- - 6 L - ] - : = ? illoma. Since then a few investigators have 01 .$+ q, !I;- d ?J shown HPV from laryngeal papilloma lesions. );I ~Z-tH 6\31 91  ill^^ 6t 01 H ]  q! :?.ill 6 \ ~  g : <; ~2~ $ 1  The mode of infection of laryngeal papil- loma is not yet clear, in contrast to condyloma which is sexually transmitted. It  is reported that there are close relationship between laryngeal papilloma of children and genital wart of their mothers(Hal1en and Majmudar, 1986), There- fore, we attempted to investigate the etiologic types of HPV of these tumors and the possible epidemiologic relationship between children's papilloma viral disease and papillomaviral in- fection of their mothers. MATERIALS AND METHODS Samples The patients were all children from the dermatologic and otolaryngologic outpatient clinics of Seoul National University Hospital. Five condyloma acuminatum and seven lar- yngeal papilloma biopsy samples were stored at -70°C. Nine cases of cervical swabs from mothers of children with condyloma or lar- yngeal papilloma, were collected with cotton ball from cervix. The collected material was sus- pended in 2ml phosphate-buffered saline and centrifuged at 4°C for 10min at 2000rpm. The pellet was stored at -70°C. Extraction of cel lular DNA The tissues and cervical swabs collected and stored seperately, were digested with pro- teinase K and RNase. DNA was isolated by phenol and chloroform extraction, and an etha- nol precipitation. Polymerase Chain Reaction PCRs were performed on each sample. one for the detection of HPVG, the other for HPV11 using the oligonucleotide primers by Melchers et a / .  (1 989)(Table 1 . ) .  Extracted DNA(0.25-0. 5ug) was mixed with PCR buffer(Tris HCl(pH 8. 3). KC1 50 mM. 1 . 5  mM MgCI2. 2OOug gelatinlml), 1 uM upstream primer, I uM down- stream primer, 200 uM dNTP and 2.5 unit of Taq DNA polymerase(Perkin-Elmer Cetus, CT, USA). The amplification was performed through 30 cycles (denaturation, 94°C ; annealing, 50°C ; extension, 72°C) on a programmable heat block(Hybaid thermal reactor: Hybaid Ltd, U. K) .  After amplification, amplified reaction mixture was then separated by electrophoresis in a 2% agarose gel or 8% polyacrylamide gel. To avoid false positive PCR results, one negative control was processed in each experiment. RESULTS After 30 cycles of amplification, amplifi- cation products were analyzed by gel electrophoresis. Figure 1 and 2 shows that the sizes of the amplified products were as Fig. 2. DNA isolated from condyloma acuminatum and laryngeal papilloma was subjected to 30 cycles of amplification with primers specific for HPVGia) and HPVl l  (b) .  (c) :  Agarose gel analysis of HPV11 specific PCR amplif icat~on of DNA extracted from cervicovaginal cel!s from mothers of children with condyloma acuminatum and laryngeal papil loma.(M; marker, N; negative control; lane 1, 2: HPV 6; lane 4, 5, 7, 9 : HPV 11 ) Table 1. Oligonucleotide primers of HPV 6 and 11 prlmers Sequence Size of product (bp) . .- - - -- - - - HPV 6lE5 : TAGTGGGCCTATGGCTCGTC(20mer) 280 T C C A T T A G C C T C C A C G G G T G ( ~ O ~ ~ ~ )  HPV 1 1  IL1 : GGAATACATGCGCCATGTGG(20rner) 360 - -- --- - CGAGCAGACGTCCGTCCTCG(2Orner) Table 2. Types of HPV in children's condyloma acuminata and juvenile laryngeal papilloma and in birth canals of their mothers Patients sample Mother's cervix Agelsex HPV6 HPV11 HPV6 HPVI 1 - . - - - F I3 + + NT Condyloma F I2 + - - - acuminatum F14 - + - + M 12 + - - - M I3 - + - + M I5 + + - - Fl1 - + - - -- ~ M 15 - + NT Laryngeal M 17 + - - - pap~llorna F 15 + - - - M I6 + - - - Fl14 + + --- - - - NT - -- NT ; not tested predicted from design of the primers 280 base pairs for HPV type 6 and 360 base pairs for HPV type 11. In a previous experiment, we demonstrated the specificity of the resulting product by oligomer hybridization(Park et a/. 1991 ). Among the five condyloma acuminata three cases had HPV type 6 and three had HPV type 11; one of these had both types. Among the seven cases of laryngeal papilloma five cases had HPV type 6 and four had HPV type 11; two of these had both types. Of the nine cervicovaginal swab specimens from mothers who had children with condyloma acuminatum or laryngeal papilloma, HPV DNA was found in two cases. The details of the results are summarized in table 2. DISCUSSION Polymerase chain reaction is an ingenious new tool for molecular biology. It is so sensitive that a single DNA molecule has been amplified, and single-copy genes are routinely extracted out of complex mixtures of genomic sequences and visualized as distinct bands on agarose gel(Guyer and Koshland 1989). Practical applications of the PCR method in dermatology include the identification of viruses, bacteria and parasites in tissue specimens, the identifi- cation of autoimmune-linked human leukocyte antigen[HLA] alleles in patients with cutaneous disease and the identification of specific viruses in certain malignancies(Kurban and Mihm 1992; Kwok and Sninsky 1989; Ou et a/. 1988). It has been reported that condyloma acuminatum and laryngeal papilloma appear to be caused by HPV6 or 11 infections(Gissmann et a/. 1983). Hallden and Majmudar(l986) had shown that in 50% of the child cases of lar- yngeal papilloma their mothers had a history of condyloma acuminatum in the delivery or preg- nancy periods. And they had insisted the close relationship between the two diseases. In the present study, all cases of laryngeal papilloma were found to have HPV DNA, and relative positivity for HPV 6 and 11 were similar with condyloma acuminata as reported by Park et a/. (1 989) with Southern blot hybridization method. Therefore it suggests that the two dis- eases might be caused by the same virus and be closely associated in the epidemiological re- spect. HPV type 16, 18 known as a major cause of cervical neoplasia has been isolated from normal cervices as well as from cervical dysplasia. This has led to speculation that HPV 16, 18 is able to persist in tissues in an asymptomatic or latent state. But it has not been found that the presence of inapparent In- fection of HPV 6, 11 is associated with condyloma acuminatum and laryngeal papil- loma. Recently Pao et a/. (1 990) has reported that HPV type 6 and 11 was found in cervicovaginal cells in about 3Ooh of normal individuals but with low levels of HPV, and that it appeared transiently. They said that the reasons for the changing appearance of HPV were not clear and the importance of HPV in cervicovaginal cells demanded a more in-depth investigation. In our study, HPV DNA was found in 2 cases among 9 cases of mothers of chil- dren with condyloma acuminatum or laryngeal papilloma. This suggests the presence of inapparent infection of HPV. But it is not clear that the infection was transmitted through either inapparent viral infection of the birth ca- nal or by other routes. The clinical importance of this inapparent infection is unclear, but i f  im- munity of the host is compromised, clinical ap- parent disease may occur by HPV as recur- rence of Herpes virus infection. Therefore, this suggests that inapparent in- fection of HPV 6, 11 in the birth canal may con- tribute to development of these viral disease in their offspring aside from sexual abuse. Latency of HPV in vaginal canal need to be studied to determine the importance of this virus in the pathogenesis of genital wart and laryngeal papilloma in these children. REFERENCES Gissmann L,  Wolnik L, lkenberg H, Koldovsky U, Schnurch HG, zur Hausen H. Human papillomavirus types 6 and 11 DNA sequences in genital and laryngeal papillomas and in some cervical cancers. Proc Natl Acad Sci USA 1983; 80560-3 Gross G, lkenberg H, Gissmann L, Hagedon M. Papilloma virus infection of the anogenital re- gion; corelation between histology, clinical picture, and virus type. propose of a new no- menclature. J Invest Dermatol 1985; 85:147-52 Guyer RL, Koshland DE. The molecule of the year. Science 1989; 246:1543-6 Hallden C, Majmudar B. The relationship be- tween juven~le laryngeal papillomatosis and maternal condyloma acum~nata.  J Repro Med 1986; 31 1804-7 Kurban RS. Mihm MC. Dermatopathology: cu- taneous reaction pattern and the use of spec~alized laboratory techniques. In: Moschella SL and Hurley HJ(Eds), Derma- tology. 3rd ed. W. B. Saunders company, Philadelphia, 1992: pp. 125-1 48 Kwok S. Sninsky JJ. Application o f  PCR to the detection of human infectious disease. In Ehrlich HA(Ed). PCR technology. Macmillan publishers LTD, New York, 1989; pp. 235-44 Melchers WJG. Schift R ,  Stolz E, Linderman J, Quint WGV. Human papillomavirus detection in urine samples from male patients by the polymerase chain reaction. J Clin Microbiol 1989; 27:1711-4 Oriel JD. Genital and anal papillomaviruses infections in human males. In Syrjanen K, Gissmann L ,  Koss LG(Eds), Papillomaviruses and human disease. Springer-Verlag, Berlin Heidelberg, 1987; pp.  182-1 96 Ou Cy, Kwok S, Mitchell SW, Mack DH, Sninsky JJ, Krebs JW, Feorino P, Warfield D, Schochetman G. DNA amplification for direct detection of HIV-1 in DNA of peripheral blood mononuclear cells. Science 1988: 239:295-7 Pao CC, Lin CY, Maa JS, Lai CH, Wa SY, Soong YK. Detection of human papillo- maviruses in cervicovaginal cells using polymerase chain reaction. J Infect Dis 1990; 161 :113-5 Park KC, Jung SY, Choi YM. Detection of geni- tal human papillomaviruses using PCR. Ann Dermatol 1991 ; 3: 37-9 Park KC, Lee SH. Lee YS, Kim YK, Park HB, Seo JS. Detection of human papillomavirus DNA in condyloma acuminata patients using mol- ecular hybridization. Kor J Dermatol 1989; 271660-5 

Detection of Human Papillomavirus(HPV) DNA in Children's Genital and Respiratory Tract Papilloma and in Birth Canals of Their Mothers

https://s-space.snu.ac.kr/bitstream/10371/5490/3/SeoulJMed34.311-314.pdf

Detection of Human Papillomavirus(HPV) DNA in Children's Genital and Respiratory Tract Papilloma and in Birth Canals of Their Mothers

Abstract

Similar works

Full text

Available Versions

SNU Open Repository and Archive