High, Katherine A.

Ho, Coty

Rose, Virgil L.

Wallmark, Anders

Carolina Digital Repository

4022 Nucleic Acids Research, Vol. 19, No. 14Dinucleotide repeat polymorphismin the IL-2R3 geneEric S.Brewster1' 2 *, Miles B.Brennan1' andHenrik Vissing1 41Brookdale Center for Molecular Biology and 2Departmentof Psychiatry, The Mount Sinai School of Medicine, 1Gustave L. Levy Place, New York, NY 10029, 3Unit onGenomics, National Institute of Mental Health, Building 10,Room 4N320, Bethesda, MD 20892, USA and4Hagedorn Research Laboratory, Niels Steensensveej 6,DK-2820 Gentofte, DenmarkSource/Description: Analysis of the published sequence of thehuman interleukin 2 receptor ,B (IL- 2R,B) gene revealed adinucleotide repeat of the form (GT)n (1). Using the DNAsequence, polymerase chain reaction (PCR) primers flanking therepeat were designed to yield an amplified fragment with apredicted length of approximately 153 bp.Primer Sequences:TG-01: 5'GAGAGGGAGGGCCTGCGTTC3'TG-02B: 5'CACCCAGGGCCAGATAAAGA3'Polymorphism and Frequency: Estimated from 11 unrelatedindividuals.Heterozygosity = 91%Allele (bp) Frequency Allele (bp) Frequency163 0.09 155 0.09161 0.09 153 0.09159 0.18 151 0.09157 0.18 149 0.18Chromosomal Localization: The IL-2Rfl gene was localized to22qll.2-ql2 by somatic cell hybrid mapping (1).Mendelian Inheritance: Co-dominant segregation was observedin four two-generation families.Other Comments: PCR amplification was performed in a totalvolume of 100 AL containing: 100 ng genomic DNA, 250 nMof each primer, 200 nM of each dNTP, 1.5 mM MgCl2, 50mM KCl, 10 mM Tris/HCl pH 9.0, 0.01 % gelatin, 0.1 % TritonX-100, and 1.25 units of Taq polymerase (Promega). PrimerTG-01 was 5' end labeled with oy-32P-dATP. After denaturationat 94°C for 3 min, amplification was carried out for 30 cycleswith denaturation at 94°C for 20 sec, annealing at 55°C for 20sec, and elongation at 72°C for 30 sec. PCR products wereresolved on a 6% polyacrylamide gel and visualized byautoradiography. Fragment sizes were determined by comparisonto an M13 sequencing ladder.References: 1) Gnarra,J.R., Otani,H., Wang,M.G.,McBride,O.W., Sharon,M. and Leonard,W.J. (1990) Proc. Natl.Acad. Sci. USA 87, 3440-3444.A NlaiV polymorphism within thehuman Factor X geneAnders Wallmarkl, Virgil L.Rose, Coty Ho andKatherine A.High*Departments of Medicine and Pathology, and the Centerfor Thrombosis and Hemostasis, The University of NorthCarolina at Chapel Hill, Chapel Hill, NC 27599-7260, USAand 'Department of Medicine, Coagulation Disorders,Malmo General Hospital, Malmo, SwedenSource/Description: We describe a sequence variant occurringin exon 7 of the gene encoding blood coagulation Factor X. Thevariant is found at residue 817 of the cDNA (numbering systemof Leytus et al. [1]), where either a C or a T may be present.The polymorphism is silent at the amino acid level, since bothtriplets (ACT-'ACC) encode threonine. The latter sequence,but not the former, forms part of a restriction enzyme recognitionsite for the enzyme NlaIV, which recognizes the sequenceGGNNCC.Frequency: Estimated from NlaIV restriction digest of PCR-amplified 315 bp fragment containing all of exon 7.Oligonucleotides used to prime amplification were 5' GGATGG-AAGCTTACCGAAGAGGAC 3' and 5' CCTACCTTCG-AATGGCTTCTCCTG 3' (from intron sequences flanking exon7). In the presence of the Dl allele (ACT), the 315 bp fragmentremains uncut by NlaIV. In the presence of the D2 allele (A-CC), fragments of 171 and 144 bp are generated. The figuredemonstrates homozygous D1, heterozygous and homozygousD2 samples.Estimated from 17 unrelated Caucasians:D1 (ACT) = 0.76D2 (ACC) = 0.24Estimated from 5 unrelated American Blacks:DI = 0.5D2 = 0.5Chromosomal Localization: The gene for human F.X has beenmapped to 13q34.Other Comments: The polymorphism may have utility for RFLPdiagnosis in F.VII mutations, since F.VH and F.X are closelylinked on chromosome 13. This polymorphism differs from otherspreviously reported within the Factor X gene [2].References: 1) Leytus. et al. (1986) Biochemistry 25,5098-5102. 2) Hassan et al. (1988) Blood 71, 1353-1356.Acknowledgements: This work was supported by National Heart,Lung, and Blood Institute Grants HL06350 and 5-K08-HL01922to K.A.H.* To whom correspondence should be addressed * To whom correspondence should be addressed

A NlalV polymorphism within the human Factor X gene

https://cdr.lib.unc.edu/downloads/vh53x396x

A NlalV polymorphism within the human Factor X gene

Abstract

Similar works

Full text

Available Versions

Carolina Digital Repository