Fundação de Amparo à Pesquisa do Estado de São Paulo (FAPESP)Conselho Nacional de Desenvolvimento Científico e Tecnológico (CNPq)The investigation of the genetic variation and population structure of Chrysomya species is of great interest for both basic and applied research. However, very limited genetic information is available for this genus across its geographical distribution. Here, we describe 12 polymorphic microsatellite loci isolated from Chrysomya putoria with expected heterozygosities ranging from 0.1402-0.8312. These markers are of potential applied interest for forensic entomologists and for the characterisation of the genetic structure of C. putoria from recently colonised regions, with great promise for understanding the colonisation dynamics and spread of the genus Chrysomya in the New World.104710471050Fundação de Amparo à Pesquisa do Estado de São Paulo (FAPESP)Conselho Nacional de Desenvolvimento Científico e Tecnológico (CNPq)Fundação de Amparo à Pesquisa do Estado de São Paulo (FAPESP)Conselho Nacional de Desenvolvimento Científico e Tecnológico (CNPq)FAPESP [03/01458-9]CNPq [471132/01-2

de Azeredo-Espin, AML

Rodrigues, RA

Torres, TT

Memórias do Instituto Oswaldo Cruz

Repositorio da Producao Cientifica e Intelectual da Unicamp

1047
online | memorias.ioc.fiocruz.br
Mem Inst Oswaldo Cruz, Rio de Janeiro, Vol. 104(7): 1047-1050, November 2009
Microsatellite markers for population genetic studies of the blowfly 
Chrysomya putoria (Diptera: Calliphoridae)
Rosangela Aparecida Rodrigues1,2, Ana Maria Lima de Azeredo-Espin1,2, Tatiana Teixeira Torres1/+
1Centro de Biologia Molecular e Engenharia Genética 2Departamento de Genética e Evolução, Universidade Estadual de Campinas, 
Campinas, SP, Brasil
The investigation of the genetic variation and population structure of Chrysomya species is of great interest for 
both basic and applied research. However, very limited genetic information is available for this genus across its geo-
graphical distribution. Here, we describe 12 polymorphic microsatellite loci isolated from Chrysomya putoria with 
expected heterozygosities ranging from 0.1402-0.8312. These markers are of potential applied interest for forensic 
entomologists and for the characterisation of the genetic structure of C. putoria from recently colonised regions, with 
great promise for understanding the colonisation dynamics and spread of the genus Chrysomya in the New World.
Key words: invasive species - forensic entomology - myiasis
Financial support: FAPESP (03/01458-9), CNPq (471132/01-2)
+ Corresponding author: tttorres@unicamp.br 
Received 17 April 2009
Accepted 16 July 2009
Chrysomya putoria is a blowfly native to Africa 
where it is of considerable medical and sanitary im-
portance as a mechanical vector of pathogens and as a 
secondary myiasis agent in man and animals (Zumpt 
1965, Guimarães & Papavero 1999). Larvae of C. pu-
toria feed on decomposing substrates (Souza & Lin-
hares 1997). Due to this habit, it is also important in 
forensic entomology, which utilise information from 
insects in death investigations (Greenberg 1991). 
Among other applications, such insects can be used 
to estimate the post-mortem interval and to determine 
whether the remains have been relocated.
Originally, C. putoria was restricted to the Old World 
and its native range extended from Tanzania to Congo 
(Zumpt 1965). Circa 1975, C. putoria was introduced to 
the New World, showing a rapid rate of dispersal across 
the Americas (Laurence 1988). Three other Old World 
Chrysomya species (Chrysomya albiceps, Chrysomya 
megacephala and Chrysomya rufifacies) have also been 
introduced into the New World (Guimarães & Papavero 
1999) and it is believed that these species have displaced 
native species through competition for substrate and 
ecological niches (Laurence 1988). Each of these in-
vader species spread with different dispersion rates and 
routes for establishing themselves across the continent, 
with varying success. Although C. putoria spread more 
rapidly, it was later outnumbered by C. albiceps and C. 
megacephala (Junqueira 2002). The characterisation of 
populations of these Chrysomya species provides an op-
portunity to study basic processes in population biology 
and may provide novel insights into the colonisation dy-
namics and spread of invasive taxa.
One essential component for successful population 
genetics studies is the availability of suitable molecular 
markers. Among the classes of molecular markers, mi-
crosatellite loci stand out as co-dominant markers with 
a high number of alleles per locus, high polymorphism 
and a high expected heterozygosity value. Because of 
these features, microsatellites have been extremely use-
ful for investigating population structure, gene flow and 
mating systems even in populations that have low levels 
of allozyme and mitochondrial gene variation (Gold-
stein & Schlötterer 1999). As a part of an effort to char-
acterise Chrysomya populations from South America 
we initially isolated microsatellite markers for C. albi-
ceps (Torres & Azeredo-Espin 2008). In this report, we 
present novel loci for C. putoria.
For library construction, we used a pool of eight pu-
pae from a laboratory culture. Genomic DNA was ex-
tracted using the PuregeneTM DNA isolation kit (Gentra 
Systems, Minneapolis, MN).
For the polymorphism assessment, adults of C. pu-
toria were collected from two sites in Brazil, São João 
da Boa Vista, São Paulo (21°58’11”S 46°47’56”W), and 
Belém, Pará (1°27’18”S 48°30’09”W). Adults of C. pu-
toria were captured by hand-net using decomposing 
liver as bait and frozen at -70°C before DNA prepara-
tion. DNA was extracted from individual flies using a 
standard phenol/chloroform procedure (Infante-Vargas 
& Azeredo-Espin 1995).
Genomic DNA from the colony-bred pupae was di-
gested with RsaI (Invitrogen, Carlsbad, CA) and blunt-
ended DNA fragments were ligated to oligonucleotide 
adapters. Fragments containing AC and AG repeats 
were selected by hybridisation to biotinylated oligo-
nucleotides complementary to the repetitive sequence 
and recovered by magnetic beads linked to streptavidin. 
Microsatellite-rich fragments were amplified by PCR, 
ligated into pGEM-T easy plasmid (Promega, Madison, 
WI) and cloned in Escherichia coli XL1-Blue cells.
Plasmids from individual colonies were prepared and 
the sequence of the inserts was determined using an ABI 
Prism Terminator Cycle sequencing kit and an ABI 377 
Microsatellite markers for C. putoria • Rosangela Aparecida Rodrigues et al.1048
automated sequencer (Applied Biosystems, Foster City, 
CA). Primer pairs complementary to sequences flank-
ing the repeat element were designed using Primer3 
software (Rozen & Skaletsky 2000).
The characterised loci were amplified using condi-
tions described in Torres and Azeredo-Espin 2008) with 
locus-specific annealing temperatures (Table I). PCR 
products were analysed on denaturing 6% polyacryl-
amide gels in a sequencing electrophoresis apparatus 
and the alleles were visualised using a standard silver 
staining protocol (Blum et al. 1987). PCR products of 
one cloned allele for each locus (using 1:1000 dilution of 
plasmid DNAs) and the 10 bp DNA ladder (Invitrogen, 
Carlsbad, CA) were used as size references.
The number of alleles per locus, the allele size range 
and the observed and expected heterozygosities were de-
termined for the polymorphic loci. Each locus was tested 
for deviations from Hardy-Weinberg equilibrium expec-
tations using exact tests implemented in Genepop (Ray-
mond & Rousset 1995). The genotypic disequilibrium 
between pairs of loci was also calculated using Genepop. 
Sequential Bonferroni corrections (Rice 1989) were ap-
plied for multiple tests performed simultaneously.
Despite the great interest in C. putoria for both basic 
and applied research in topics such as the dynamics of 
invasive species, forensic entomology and human health, 
no study has been published on the genetic characterisa-
tion of geographic populations of this species. Since the 
first requirement for any population genetic study is the 
availability of a reliable set of polymorphic markers, we 
isolated and characterised a core set of twelve polymor-
phic microsatellite loci for C. putoria.
We sequenced 130 clone inserts from the enriched 
library, 52 of which had a microsatellite. Among these, 
20 were chosen for designing primers for the amplifica-
tion of loci. Of the 20 loci characterised, 12 were poly-
morphic and could be amplified consistently, one was 
monomorphic and primers for the remaining loci failed 
to produce a reliable product. Primer sequences, micro-
satellite motifs and other related information for each 
locus are detailed in Table I.
Polymorphism was assessed using wild-caught indi-
viduals of C. putoria from two sampling sites in Brazil. 
In the two C. putoria populations, the number of alleles 
per locus ranged from 3-8, with an average of 5.3. This 
TABLE I
Characterization of the microsatellite loci isolated from Chrysomya putoria
Locus
Genbank 
accession Primer sequence (5’→ 3’)
Ta
(oC)
Repeat motif in 
the cloned allele
Size of the cloned 
allele (bp)
Allele size
range
(bp)
Number 
of alleles
CP02 - F:CGGAACCTTTATCCTTCCR:TGCACTTGTTGTTCAACTTC 56 (AC)3ATACAA(AC)7 126 - 1
CP04 FJ447469 F:ACTGCATTGATATGTGTATTGR:GAACATTTTTCCAACCAC 58 (AC)8 148 142-146 3
CP05 FJ447470 F:CCTTTACTTTAAGCCCTTCCR:GGTTTGGTGGAAAAGAGAC 62 (AG)10A(AG)2 157 157-177 6
CP06 FJ447471 F:AAACACTATTGCAAAATACCR:ATTTCCTTCCTATTTGTTG 54 (GA)9GC(GA)2 156 150-166 7
CP07 FJ447472 F:AGGGAAACAGACCATAACGR:GCATAAATGCATATTTGTAAAG 58 (CA)18 167 149-167 7
CP09 FJ447473 F:AAGTTTACATTCATTCGTTGGR:CGATTTGCCATCCCTATG 58 (AG)11 139 123-141 6
CP10 FJ447474 F:TGTTCAGCAATTCTGTCGR:GGGTCTAAAAAGTGCATGG 56 (GA)8 149 149-157 3
CP12 FJ447475 F:AAGCTTTTACCACACTTGR:GCATATAGTTGATAATGTCC 58 (CA)9 215 189-219 5
CP14 FJ447476 F:CCTCAATATACATACAACAAGCR:ACGCCAACAAACGTAGAG 58 (AC)8 179 173-197 8
CP15 FJ447477 F:ACGACAGACCTTGTTATTTGR:CCAACACACAGAAAATTG 56 (AC)9 207 199-217 4
CP16 FJ447478 F:TGCGTGTGTATTACATTGCR:ACCACTACTCAAAGGTCTCG 62 (CAA)2TAA(CAA)4 247 229-250 4
CP19 FJ447479 F:CCATCAACCAAGTAAATCR:TAAAGGTTTAGCCTTCAG 54 (AC)2AT(AC)8 124 116-124 5
CP20 FJ447480 F:CACATGACCCAAAAGTCCR:ACCTAAACGGCAACACTG 62 (AC)8 200 194-204 6
Ta: annealing temperature.
1049Mem Inst Oswaldo Cruz, Rio de Janeiro, Vol. 104(7), November 2009
TABLE II
Polymorphism assessment on the microsatellite loci isolated from Chrysomya putoria using two geographical populations
Locus
São João da Boa Vista, São Paulo 
n = 14
Belém, Pará
n = 16
Number of 
alleles Ho He p-value
Number of 
alleles Ho He p-value
CP04 3 0.1428 0.1402 1.0000 3 0.3125 0.2802 1.0000
CP05 4 0.1667 0.7138 0.0000a,b 5 0.0714 0.7434 0.0000a,b
CP06 6 0.0000 0.8312 0.0000a,b 4 0.1428 0.7143 0.0000a,b
CP07 5 0.4545 0.7099 0.1545 6 0.5333 0.6552 0.4817
CP09 4 0.4615 0.6062 0.0943 5 0.1428 0.8122 0.0000a
CP10 2 0.0000 0.3492 0.0010a,b 3 0.0000 0.6234 0.0000a,b
CP12 5 0.5714 0.8095 0.0004a,b 4 0.1875 0.5343 0.0011a,b
CP14 7 0.5000 0.7884 0.0269 6 0.2667 0.7908 0.0000a
CP15 3 0.0769 0.4954 0.0003a 3 0.1250 0.1794 0.0926
CP16 3 0.2143 0.4153 0.0408 3 0.2143 0.6243 0.0033a
CP19 5 0.7857 0.6772 0.6393 4 0.5333 0.6000 0.1403
CP20 4 0.3571 0.6190 0.0024a 6 0.4375 0.8125 0.0047
a: denotes a significant (α = 0.05) deviation from equilibrium after sequential Bonferroni correction (Rice 1989); b: the loci de-
viating from equilibrium in both populations; He: expected heterozygosity; Ho: observed heterozygosity. The p-values reported 
are from the tests of Hardy-Weinberg equilibrium.
average was slightly smaller than the average number 
of alleles observed in C. albiceps microsatellites, 5.7 
(Torres & Azeredo-Espin 2008), but both were substan-
tially smaller than the average allele number per locus 
observed in the native South American Calliphoridae, 
Chrysomya hominivorax, 7.4 (Torres et al. 2004, Tor-
res & Azeredo-Espin 2005). The reduced variability at 
Chrysomya microsatellite loci is in agreement with the 
expectation that introduced populations show reduced 
levels of diversity because of founder effects and post-in-
troduction demographic bottlenecks (Dlugosch & Parker 
2008). The comparison of these data to further studies 
on native populations in Africa using these markers will 
allow a direct estimation of the effect of bottleneck on 
the genetic variability of introduced populations.
The observed and expected heterozygosities ranged 
from 0-0.7857 and from 0.1402-0.8312, respectively 
(Table II). Four loci showed significant heterozygote 
deficits in both populations. Two and three loci devi-
ated from equilibrium in only one population, São João 
da Boa Vista and Belém, respectively. No significant 
linkage disequilibrium was detected after sequential 
Bonferroni correction.
The significant departures from Hardy-Weinberg 
equilibrium at multiple loci may result from periodic 
changes in post-colonisation population size, strong 
selection effects in the new environment or re-intro-
ductions. Alternatively, departures from the equilib-
rium could be due to the presence of null alleles in the 
characterised loci. Such artefacts result from mutations 
such as substitutions, insertions and/or deletions in one 
or both priming sites. This prevents the binding of the 
DNA strand and primers, resulting in non-amplification 
of the allele (Callen et al. 1993). The study of additional 
populations from the Americas and their historical dis-
tributions will shed light onto this question.
The loci described herein will be useful for investi-
gating the structure of C. putoria populations from their 
original distribution as well as dispersal and colonisation 
dynamics in the invaded regions. The combined analysis 
of introduced Chrysomya populations will be an impor-
tant component in understanding processes shaping their 
evolution after the New World invasion. Furthermore, a 
comprehensive genetic analysis of C. putoria popula-
tions using these markers is of potential applied interest 
for forensic entomologists. Such investigation would be 
useful in assigning specimens to particular geographic 
locations and for kinship analysis by providing basic 
information to infer post-mortem relocation of corpses 
(Wells & Stevens 2008).
ACknowLEDgEMEnTs
To Alessandra Staffocker, for valuable technical assistance, 
and to Maria Salete Couto, for maintaining the blowfly colonies.
REfEREnCEs
Blum H, Beier H, Gross HJ 1987. Improved silver staining of plant 
proteins, RNA and DNA in polyacrylamide gels. Electrophoresis 
8: 93-99.
Callen DF, Thompson AD, Shen Y, Phillips HA, Richards RI, Mulley 
JC, Sutherland GR 1993. Incidence and origin of “null” alleles in 
the (AC)n microsatellite markers. Am J Hum Genet 52: 922-927.
Dlugosch KM, Parker IM 2008. Founding events in species invasions: 
genetic variation, adaptive evolution and the role of multiple in-
troductions. Mol Ecol 17: 431-449.
Microsatellite markers for C. putoria • Rosangela Aparecida Rodrigues et al.1050
Goldstein D, Schlötterer C 1999. Microsatellites: evolution and ap-
plications, Oxford University Press, Oxford, 368 pp.
Greenberg B 1991. Flies as forensic indicators. J Med Entomol 
28: 565-577.
Guimarães JH, Papavero N 1999. Myiasis in man and animals in the 
neotropical region - Bibliographic database, Plêiade/FAPESP, 
São Paulo, 308 pp.
Infante-Vargas ME, Azeredo-Espin AML 1995. Genetic variability 
in mitochondrial DNA of screwworm, Cochiomyia hominivorax 
(Diptera: Calliphoridae), from Brazil. Biochem Genet 33: 737-756.
Junqueira ACM 2002. Utilização do aDNA para estudos genético-
evolutivos relacionados a introdução e dispersão de Chrysomya 
putoria (Diptera: Calliphoridae) no Brasil, PhD Thesis, Univer-
sidade Estadual de Campinas, Campinas, 192 pp.
Laurence BR 1988. The tropical African latrine blowfly, Chrysomya 
putoria (Wiedemann). Med Vet Entomol 2: 285-291.
Raymond M, Rousset F 1995. GENEPOP (version 1.2): population 
genetics software for exact tests and ecumenicism. J Hered 
86: 248-249.
Rice WR 1989. Analyzing tables of statistical tests. Evolution 43: 223-225.
Rozen S, Skaletsky H 2000. Primer3 on the www for general users 
and for biologist programmers. Methods Mol Biol 132: 365-386.
Souza AM, Linhares AX 1997. Diptera and Coleoptera of potential 
forensic importance in Southeastern Brazil: relative abundance 
and seasonality. Med Vet Entomol 11: 8-12.
Torres TT, Azeredo-Espin AML 2005. Development of new polymor-
phic microsatellite markers for the New World screw-worm Co-
chliomyia hominivorax (Diptera: Calliphoridae). Mol Ecol Notes 
5: 815-817.
Torres TT, Azeredo-Espin AML 2008. Characterization of polymor-
phic microsatellite markers for the blowfly Chrysomya albiceps 
(Diptera: Calliphoridae). Mol Ecol Resour 8: 208-210.
Torres TT, Brondani RPV, Garcia JE, Azeredo-Espin AML 2004. 
Isolation and characterization of microsatellite markers in the 
new world screw-worm Cochliomyia hominivorax (Diptera: Cal-
liphoridae). Mol Ecol Notes 4: 182-184.
Wells JD, Stevens JR 2008. Application of DNA-based methods in 
forensic entomology. Annu Rev Entomol 53: 103-120.
Zumpt F 1965. Myiasis in man and animals in the Old World, But-
terworths, London, 267 pp.


Microsatellite markers for population genetic studies of the blowfly Chrysomya putoria (Diptera: Calliphoridae)

http://repositorio.unicamp.br/jspui/bitstream/REPOSIP/56773/1/WOS000272928800020.pdf

Microsatellite markers for population genetic studies of the blowfly Chrysomya putoria (Diptera: Calliphoridae)

Abstract

Similar works

Full text

Available Versions

Repositorio da Producao Cientifica e Intelectual da Unicamp