Antheraea assama, an economically important and scientifically unexplored Indian wild silkmoth, is unique among saturniid moths. For this species, a total of 87 microsatellite markers was derived from 35 000 expressed sequence tags and a microsatellite-enriched sub-genomic library. Forty individuals collected from Tura and West Garo Hills region of Northeast India were screened for each of these loci. Ten loci from expressed sequence tags and one from genomic library were found to be polymorphic. These microsatellite markers will be useful resources for population genetic studies of A. assama and other closely related species of saturniids. This is the first report on development of microsatellite markers for any saturniid species

Arunkumar, K. P.

Kifayathullah, L.

Nagaraju, J.

English

Publications of the IAS Fellows

Molecular Ecology Resources (2009) 9, 268–270 doi: 10.1111/j.1755-0998.2008.02414.x
© 2008 The Authors
Journal compilation © 2008 Blackwell Publishing Ltd
Blackwell Publishing LtdPERMANENT GENETIC RESOURCES
Microsatellite markers for the Indian golden silkmoth, 
Antheraea assama (Saturniidae: Lepidoptera)
K.  P.  ARUNKUMAR, L .  KIFAYATHULLAH and J .  NAGARAJU
Centre of Excellence for Genetics and Genomics of Silkmoths, Laboratory of Molecular Genetics, Centre for DNA Fingerprinting and 
Diagnostics, ECIL Road, Nacharam, Hyderabad  500 076, India
Abstract
Antheraea assama, an economically important and scientifically unexplored Indian wild
silkmoth, is unique among saturniid moths. For this species, a total of 87 microsatellite
markers was derived from 35 000 expressed sequence tags and a microsatellite-enriched
sub-genomic library. Forty individuals collected from Tura and West Garo Hills region of
Northeast India were screened for each of these loci. Ten loci from expressed sequence tags
and one from genomic library were found to be polymorphic. These microsatellite markers
will be useful resources for population genetic studies of A. assama and other closely
related species of saturniids. This is the first report on development of microsatellite markers
for any saturniid species.
Keywords: Antheraea assama, EST-SSRs, genetic variation, genomic-SSRs
Received 17 June 2008; revision accepted 25 August 2008
Indian golden silkmoth (Antheraea assama) popularly known
as muga silkmoth, is a semi-domesticated, polyvoltine and
polyphagous lepidopteran insect, endemic to northeastern
India. Unlike other silkmoths, A. assama has low chromo-
some number (n = 15) (Deodikar et al. 1962) and ZZ/ZO
sex chromosome system (Gupta & Narang 1981). Antheraea
assama is known for its production of quality silk with
natural golden colour, glossy fine texture and durability.
Large-scale production of the golden yellow silk from A.
assama is practiced by farmers of the Brahmaputra valley of
Assam and its bordering states of India. The muga silk has
now secured geographical indication status, the recognition
under the intellectual property rights that it has its origin in
Assam region. Over the past two decades, there have been
reports that the natural populations of A. assama have
experienced declines that are attributed to continued
deforestation activities, population fragmentation and
inbreeding. The decline in muga silkworm population has
raised concern among silkworm farmers and conserva-
tionists. The aim of the present study was to develop
informative microsatellite markers that could be used in
analysing genetic structure and phylogenetic status of this
species. With the knowledge of information and importance
of microsatellites that reside in the exonic parts of the
genome of various organisms, we have developed expressed
sequence tag–simple sequence repeats (EST–SSR) for A.
assama. In addition, we have also developed microsatellite
markers from repeat enriched genomic library constructed
from A. assama DNA.
To develop EST–SSR markers, 8200 unique sequences
derived from 35 000 A. assama ESTs (Arunkumar et al. 2008)
were screened using Webtroll (Tandem Repeat Occurrence
Locator) software (Castelo et al. 2002) for SSRs harbouring
di-, tri-, tetra- and pentanucleotide repeats. A total of 63
sequences was selected from unique ESTs and of which 35
were di-, 12 tri-, 4 tetra- and 2 pentanucleotide repeat contain-
ing sequences. Ten ESTs harboured compound repeat motifs.
For the construction of genomic library, DNA was isolated
using the method described earlier (Prasad & Nagaraju
2003) from A. assama pupae. Genomic DNA was enriched
using an oligonucleotide mix of (ATT)8, (GAGT)2, (CA)10,
(GA)10, (GATA)10, (CAC)7 and (AGC)7 following previously
reported protocol (Glenn & Schable 2005). In short, DNA
Correspondence: J. Nagaraju, Fax: 91-40-27155610; 
E-mail: jnagaraju@cdfd.org.in
P E R M A N E N T  G E N E T I C  R E S O U R C E S 269
© 2008 The Authors
Journal compilation © 2008 Blackwell Publishing Ltd
was digested with RsaI and XmnI restriction enzymes
(New England Biolabs Inc.), ligated to double-stranded
superSNX linkers, hybridized with biotinylated micro-
satellite oligonucleotides and captured on streptavidin-coated
magnetic beads. Unhybridized DNA was washed away
and the captured DNA was recovered by polymerase chain
reaction (PCR) using the single stranded superSNX-F as a
primer. The PCR products were ligated into the pCR4-TOPO
TA vector (Invitrogen) and transformed into XL1-Blue
competent cells. Colony PCR was performed to select the
amplicons of size 500–1000 bp and purified using the
AMPure PCR purification systems (Agencourt Bioscience).
In total, 134 of the 185 colonies screened contained inserts
of more than 500 bp. These inserts were amplified using
M13 primers and sequenced on an ABI PRISM 3100 Genetic
Analyser (Applied Biosystems), with BigDye Terminator
(version 3.1) chemistry. Only 24 of the 134 inserts were
harbouring microsatellite repeats.
Primer 3 program (Rozen & Skaletsky 2000) was used
to design primers flanking SSRs in the EST clusters and
microsatellite-enriched sequences. PCR was carried out on
a Mastercycler Gradient (Eppendorf) in a 10-μL reaction
containing 1× PCR buffer (10 mm Tris-HCl, pH 8.8, 50 mm
KCl) (MBI Fermentas), 100 μm dNTPs, 1.5 mm MgCl2, 5
pmol of each primers, 10 ng of genomic DNA as template
and 0.5 U Taq polymerase (MBI Fermentas). The PCR
conditions were initial denaturation of 94 °C for 3 min, 35
cycles of 94 °C denaturation for 20 s, appropriate annealing
temperature (established empirically) for 10 s and 72 °C
extension for 45 s, and 72 °C for 10 min as final extension.
Of the 63 EST–SSRs and 24 genomic SSRs, 51 and 19 gave
amplification, respectively, as assessed 1.5% agarose gel
electrophoresis. These 70 primer pairs were then tested on
40 individual A. assama genomic DNA samples extracted
from pupae collected from Tura (20 nos.) and West Garo
Hills (20 nos.) region of Northeast India. The sampling
locations are 60 km apart. The amplified products were
then analysed on 3.0% agarose gel (Hi Resolution, Sigma-
Aldrich) along with 50 bp size standard (MBI Fermentas)
at 90 V for 3.5 h and visualized by ethidium bromide
staining. The alleles were scored using the Bio-Rad Quantity
One Software (Bio-Rad Laboratories). A sample of indi-
viduals was also screened on denaturing PAGE using the
same primer sets to check for the allele sizes.
Only 10 of the 51 EST–SSRs were polymorphic upon
screening 40 individuals. Twenty-eight loci were mono-
morphic with single band pattern. Thirteen primer pairs
gave bands with size range more than expected and were
monomorphic. The possible reasons for unexpected size
range of EST–SSR loci are, one or both primers of the
EST–SSR extend across a splice site and presence of introns
and insertions/deletions (indels) in the corresponding
genomic sequence (Varshney et al. 2005). Of the 19 genomic
SSRs, only one locus was polymorphic with three alleles
across 40 individuals. The software genalex version 6
(Peakall & Smouse 2006) was used to calculate allele fre-
quency, observed mean and expected heterozygosity. The
observed and expected heterozygosities ranged from 0 to
0.737 and from 0.095 to 0.825, respectively, with the allele
numbers of two to eight. Pairwise tests for linkage disequi-
librium were performed using Web-based program GenePop
version 3.4 (Raymond & Rousset 1995). In Tura population,
we observed a significant linkage disequilibrium for three
of the 35 pairwise comparisons between loci after sequen-
tial Bonferroni correction, particularly involving loci
AaSat002, AaSat020, AaSat044 and AaSat065. However, only
one pair (AaSat001 and AaSat053) out of 27 combinations
showed significant deviation from linkage disequilibrium
in West Garo Hills population. The linkage disequilibrium
observed at certain loci may be due to substructure of
population or bottleneck. Further studies are needed to
clarify this discrepancy. Only three of the nine loci poly-
morphic in Tura population showed no significant deviation
from Hardy–Weinberg equilibrium (HWE). The remaining
six deviated significantly from HWE and three of them
(AaSat002, AaSat020 and AaSat053) showed large hetero-
zygote deficiencies. Eight microsatellite markers were
found to be polymorphic in West Garo Hills population, of
which only two were in HWE (Table 1). The presence of
null alleles at each locus was tested using Micro-Checker
version 2.2.3 (van Oosterhout et al. 2004). The three loci
AaSat002, AaSat020 and AaSat053 that deviated from HWE
also exhibited overall significant excess of homozygotes
with null allele frequency of 0.435, 0.366 and 0.198, respec-
tively, possibly indicating the presence of null alleles in
Tura population. In the West Garo Hills population, four
loci AaSat008, AaSat14 AaSat044 and AaSat040 that also
deviated from HWE showed homozygote excess with null
allele frequency of 0.2401, 0.3714, 0.4527 and 0.4438, respec-
tively. Furthermore, in the West Garo Hills population, only
less than half of the samples was successfully genotyped
with markers AaSat040 and AaSat044 suggesting a high
frequency of null alleles in this population. Taken together,
these results suggest that the deviation from HWE of many
loci may be due to Wahlund’s effect caused by subpopulation
structure (Wahlund 1928), which has to be studied further.
The loci which showed significant linkage disequilibrium
and deviation from HWE in Tura region population did not
exhibit same features in West Garo Hills population, indi-
cating that the 11 microsatellite markers developed in the
present study are independent and useful for population
genetic studies.
The polymorphic EST and genomic SSRs developed in the
present study will be particularly useful to study inbreeding
effects, population structure and founder effects. As there
are no microsatellite markers developed in other saturniid
moths, these markers can also be tested for their cross-species
amplification.
270 P E R M A N E N T  G E N E T I C  R E S O U R C E S
© 2008 The Authors
Journal compilation © 2008 Blackwell Publishing Ltd
Acknowledgements
J.N. acknowledges Centre of Excellence grant from the Department
of Biotechnology, Government of India. K.P.A. is recipient of the
fellowship from Council of Scientific and Industrial Research
(CSIR), India.
References
Arunkumar KP, Tomar A, Daimon T, Shimada T, Nagaraju J (2008)
WildSilkbase: an EST database of wild silkmoths. BMC Genomics,
9, 338.
Castelo AT, Martins W, Gao GR (2002) troll-tandem repeat
occurrence locator. Bioinformatics, 18, 634–636.
Deodikar GB, Chowdhury SN, Bhuyan BN, Kshirsagar KK (1962)
Cytogenetic studies in Indian silkworms. Current Science, 31,
247–248.
Glenn TC, Schable NA (2005) Isolating microsatellite DNA loci.
Methods in Enzymology, 395, 202–222.
Gupta ML, Narang RC (1981) Karyotype and meiotic mechanism
in muga silkmoths, Antheraea compta Roth. and A. assamensis
(Helf.) (Lepidoptera: Saturniidae). Genetica, 57, 21–27.
van Oosterhout C, Hutchison WF, Wills DPM, Shipley P (2004)
Micro-Checker: software for identifying and correcting
genotyping errors in microsatellite data. Molecular Ecology Notes,
4, 535–538.
Peakall R, Smouse PE (2006) genalex 6: genetic analysis in Excel.
Population genetic software for teaching and research. Molecular
Ecology Notes, 6, 288–295.
Prasad MD, Nagaraju J (2003) A comparative phylogenetic analysis
of full-length mariner elements isolated from the Indian tasar
silkmoth, Antheraea mylitta (Lepidoptera: saturniidae). Journal of
Biosciences, 28, 443–453.
Raymond M, Rousset F (1995) GenePop (version 1.2): population
genetics software for exact tests and ecumenicism. The Journal of
Heredity, 86, 248–249.
Rozen S, Skaletsky H (2000) Primer 3 on the WWW for general
users and for biologist programmers. Methods in Molecular
Biology, 132, 365–386.
Varshney RK, Graner A, Sorrells ME (2005) Genic microsatellite
markers in plants: features and applications. Trends in Biotech-
nology, 23, 48–55.
Wahlund S (1928) Zusammensetzung von Population und Korre-
lationserscheinung vom Standpunkt der Vererbungslehre aus
betrachtet. Hereditas, 11, 65–106.
Table 1 Characteristics of 10 expressed sequence tag-derived and one genomic simple sequence repeat markers of Antheraea assama 
Locus 
(GenBank) Source
Forward/reverse 
primers (5′–3′) Repeat motif
Size range 
(bp) Ta
Tura population West Garo Hills population
N/NA HE HO N/NA HE HO
AaSat001 
(EU597692)
EST GTGTTCATTTCACGGAACATT (TA)7 182–200 53 20/2 0.455 0.700* 16/3 0.521 0.438*
CATTCGCTGTTCGTCTGAGAT
AaSat002 EST TCTGGACAAATTGTAAAAGCTGTAG (GTCT)5 130–149 51 19/3 0.609 0.000* 19/6 0.770 0.632
(EU597693) ACAAAACGAAAATCGCGTGT
AaSat008 EST CACGAAATGCCTCTGTCGTA (TA)6 Nn (CA)9 
Nn (CA)5
199–249 51 Mono — — 19/4 0.432 0.211*
(EU597695) GGTGTCTGTGGATGATGTGC
AaSat014 EST ATCTCTACCTACGCCGACGA (GAT)5 (TAA)4 260–264 48 Mono — — 19/2 0.388 0.000*
(EU597696) AATTCGGCACGAGGAGTTC
AaSat020 EST TTTCTTCGGTTCGTTTGGTT (TCGTG)5 164–226 53 20/2 0.375 0.000* 19/8 0.825 0.737
(EU597697) GACACGCGTTGCTTTGAGTA
AaSat040 EST CGGACGTAACATTTGTCTGG (AT)17 133–221 60 16/2 0.430 0.625* 7/4 0.694 0.000*
(EU597698) CCACATGACTCTCATCAGCA
AaSat044 EST CACCAGCTTCCAAAGAATTG (AT)20 194–226 51 17/3 0.657 0.588 9/3 0.642 0.000*
(EU597699) CTAAAGCCCACGGGTTCATA
AaSat053 EST GAGTTCGGGTCGGACGTAAT (ATT)4 N7 
(ATC)6
204–225 50 20/2 0.095 0.000* 18/5 0.648 0.333*
(EU597700) TCTCTACCTACGCCGACGAC
AaSat059 EST CGAATAGCCGATTCCCTTTG (TGCG)16 103–187 55 17/4 0.715 0.529* Mono — —
(EU597701) TGCAAGCACGCACGTATC
AaSat065 EST GTCGAGCTGTCATAATTCCT (AT)11 Nn (AT)11 
(TA)5
100–168 54 18/2 0.375 0.500 Mono — —
(EU597702) AGTCTGACGTCGCTATAACC
AaGSat019 Genomic GATGGACTGGACCTCAATCG (TGA)2 (AGA)3 151–172 55 18/3 0.248 0.278 Mono — —
(EU597703) CCTGAGGAGAGAGGCGATG
Ta, annealing temperature; N, number of individuals scored; NA, number of alleles; Ho, observed and HE, expected heterozygosities; 
*significant deviation from Hardy–Weinberg equilibrium (P < 0.001). Data obtained upon screening 40 individuals (20 individuals each 
from Tura and West Garo Hills populations).


Microsatellite markers for the Indian golden silkmoth, Antheraea assama (Saturniidae: Lepidoptera)

Indian Academy of Sciences

http://repository.ias.ac.in/24345/1/355.pdf

Microsatellite markers for the Indian golden silkmoth, Antheraea assama (Saturniidae: Lepidoptera)

Abstract

Similar works

Full text

Available Versions

Publications of the IAS Fellows

Indian Academy of Sciences