Premise of study: Twenty mierosalellite loci were developed for the federally threatened species Hexastylis nanillor (Aristolochiaceae) to examine genetic diversity and to distinguish this species from co-occurring congeners, H. heterophylla and H. minor. Methods and Results: Next-generation sequencing approaches were used to identify microsatellite loci and design primers. One hundred fifty-two primer pairs were screened for repeatability, and 20 of these were further characterized for polymorphism. In H. naniflora, the number of alleles identified for polymorphic loci ranged from two to 23 (mean -8.8), with a mean heterozygosit y of 0.39. Conclusions: These 16 polymorphic primers for H. naniflora will be useful tools in species identification and quantifying genelic diversity within the genus

Estep, Matt

NC DOCKS at Appalachian State University

English

The University of North Carolina at Greensboro

Archived version from NCDOCKS Institutional Repository http://libres.uncg.edu/ir/asu/ Sixteen Polymorphic Microsateliate Markers For A Federally Threatened Species, Hexastylis Naniflora (Aristolochiaceae), And Co-Occurring CongenersAuthors:   Jacqueline W.  Hamstead,   Brandon  L. Snider ,   Robyn Oaks ,   Evan Fitzgerald,   Jason  Woodward,   Alyssa  Teat,  Nikolai  M. Hay , Matt  C. Estep And  Zack  E.  Murrell     AbstractPremise of study: Twenty mierosalellite loci were developed for the federally threatened species Hexastylis nanillor (Aristolochiaceae) to examine genetic diversity and to distinguish this species from co-occurring congeners, H. heterophylla and H. minor. Methods and Results: Next-generation sequencing approaches were used to identify microsatellite loci and design primers. One hundred fifty-two primer pairs were screened for repeatability, and 20 of these were further characterized for polymorphism. In H. naniflora, the number of alleles identified for polymorphic loci ranged from two to 23 (mean -8.8), with a mean heterozygosit y of 0.39. Conclusions: These 16 polymorphic primers for H. naniflora will be useful tools in species identification and quantifying genelic diversity within the genus.Jacqueline W.  Hamstead,   Brandon  L. Snider ,   Robyn Oaks ,   Evan Fitzgerald,   Jason  Woodward,   Alyssa  Teat,  Nikolai  M. Hay , Matt  C. Estep And  Zack  E.  Murrell (2015) "Sixteen Polymorphic Microsateliate Markers For A Federally Threatened Species, Hexastylis Naniflora (Aristolochiaceae), And Co-Occurring Congeners" Applications in Plant Sciences   3 (7)  Version of Record Available At www.BioOne.com BioOne sees sustainable scholarly publishing as an inherently collaborative enterprise connecting authors, nonprofit publishers, academic institutions, researchlibraries, and research funders in the common goal of maximizing access to critical research.Sixteen Polymorphic Microsatellite Markers for a Federally Threatened Species,Hexastylis naniflora (Aristolochiaceae), and Co-Occurring CongenersAuthor(s): Jacqueline W. Hamstead, Brandon L. Snider, Robyn Oaks, Evan Fitzgerald, Jason Woodward,Alyssa Teat, Nikolai M. Hay, Matt C. Estep, and Zack E. MurrellSource: Applications in Plant Sciences, 3(7)Published By: Botanical Society of AmericaDOI: http://dx.doi.org/10.3732/apps.1500033URL: http://www.bioone.org/doi/full/10.3732/apps.1500033BioOne (www.bioone.org) is a nonprofit, online aggregation of core research in the biological, ecological, andenvironmental sciences. BioOne provides a sustainable online platform for over 170 journals and books publishedby nonprofit societies, associations, museums, institutions, and presses.Your use of this PDF, the BioOne Web site, and all posted and associated content indicates your acceptance ofBioOne’s Terms of Use, available at www.bioone.org/page/terms_of_use.Usage of BioOne content is strictly limited to personal, educational, and non-commercial use. Commercial inquiriesor rights and permissions requests should be directed to the individual publisher as copyright holder.1 of 3 Applications in Plant Sciences  2015  3 ( 7 ): 1500033 Applications in Plant Sciences  2015  3 ( 7 ): 1500033; http://www.bioone.org/loi/apps ©  2015  Hamstead et al. Published by the Botanical Society of America. This work is licensed under a Creative Commons Attribution License (CC-BY-NC-SA). Applicationsin Plant Sciences The segregate genus  Hexastylis Raf. (Aristolochiaceae), of-ten included in  Asarum L., is an enigmatic group of 12 species distributed in the southeastern United States ( Blomquist, 1957 ;  Niedenberger, 2010 ).  Hexastylis has been segregated based upon its entirely North American distribution, karyotype ( Sugawara, 1981 ;  Soltis, 1984 ), pollen morphology ( Niedenberger, 2010 ), and several characteristics of fl ower morphology ( Gaddy, 1987 ). Multiple species complexes have been identifi ed in this genus and this study focuses on the  H. heterophylla complex, containing  H. heterophylla (Ashe) Small,  H. minor (Ashe) H. L. Blomq., and  H. nanifl ora H. L. Blomq. The species in this complex are sympatric over portions of their ranges. Vegetative characters have limited taxonomic value, leaving ephemeral fl oral morphology as the only diagnosable fi eld character for identifi cation. Previous studies have recognized intermediate fl oral morphologies in some populations, leading some to ques-tion the validity of species circumscriptions. This is particularly problematic in  H. nanifl ora , where land managers and conser-vation biologists are tasked with protection of this federally threatened species.  Through funding from the North Carolina Department of Transportation, 16 polymorphic microsatellite markers were developed to help distinguish  H. nanifl ora from  H. minor and  H. heterophylla , to address questions of hybridization, and to identify evolutionarily signifi cant units to aid in the manage-ment of these species. These markers have the potential to iden-tify species and hybrids in their vegetative state, allowing land managers to evaluate population value and management strate-gies throughout the year, instead of only during the short fl ow-ering period.  METHODS AND RESULTS  Leaf tissue was collected and preserved on silica gel from plants at 15 sites in North and South Carolina (Appendix 1). Tissue samples from one plant of  H. nanifl ora and one plant of  H. heterophylla (selected from geographic ranges where the species do not overlap and confi dently identifi ed using fl ower mate-rial) were sent to the Cornell University Evolutionary Genetics Core Facility where total DNA was extracted using a QIAGEN Plant Mini Kit (QIAGEN, Valencia, California, USA). Restriction enzymes  Alu I,  Hpy 166II, and  Rsa I (New England Biolabs, Ipswich, Massachusetts, USA) were used to digest the DNA, which was then ligated to an Illumina Y-adapter (Illumina, San Diego, California, USA) using T4 DNA ligase. The DNA fragments were then hybridized to 3 ′ biotinylated oligonucleotide repeat probes: (GT) 8 , (TC) 9.5 , (TTTTG) 4.2 , (TTTTC) 4.6 , (TTC) 7 , (GTA) 8.33 , (GTG) 4.67 , (TCC) 5 , (GTT) 6.33 , (TTTC) 6 , (GATA) 7 , (TTAC) 6.75 , (GATG) 4.25 , (TTTG) 5.25 , (TTTTG) 4.2 , (TTTTC) 4.6 . Enriched frag-ments were then captured by streptavidin-coated magnetic beads (New England Biolabs) and PCR amplifi ed. Agarose gel and a Qubit 2.0 Fluorometer (Life Technologies, Grand Island, New York, USA) were used to analyze the PCR product, and fragments 300–600 bp were recovered with AMPure beads (Beck-man Coulter , Brea, California, USA). Samples were then moved to Cornell Life Sciences Sequencing and Genotyping Facility for sequencing on an Illumina MiSeq. Raw sequence reads were then assembled using SeqMan NGen (v.11, Lasergene Genomics Suite; DNASTAR , Madison, Wisconsin, USA). Contigs containing microsatellite repeats were identifi ed using MSATCOMMANDER version 1.0.3 ( Faircloth, 2008 ), and possible primer pairs were identifi ed.  One hundred fi fty-two primer pairs were selected to screen for amplifi cation in eight individuals: six  H. nanifl ora , one  H. heterophylla , and one  H. minor. PCR amplifi cations were prepared in a 10- μ L reaction consisting of GoTaq Flexi Buffer, 2.5 mM MgCl 2 , 800  μ M dNTPs, 0.5  μ M of each primer, 0.5 units  1 Manuscript received 25 March 2015; revision accepted 27 April 2015.  We acknowledge Margaret Roberts, Taylor Jenson, and George Godsmark for efforts that were vital to the collection of plant material. We also thank the Department of Biology at Appalachian State University, the North Carolina Department of Transportation, and the North Carolina Natural Heritage Program for funding and support.  3 Author for correspondence: estepmc@appstate.edu  doi:10.3732/apps.1500033  PRIMER NOTE  SIXTEEN POLYMORPHIC MICROSATELLITE MARKERS FOR A FEDERALLY THREATENED SPECIES,  HEXASTYLIS NANIFLORA  (ARISTOLOCHIACEAE), AND CO-OCCURRING CONGENERS 1  JACQUELINE  W.  HAMSTEAD 2 ,  BRANDON  L.  SNIDER  2  ,  ROBYN  OAKS  2  ,  EVAN  FITZGERALD  2  ,  JASON  WOODWARD  2  ,  ALYSSA  TEAT  2  ,  NIKOLAI  M.  HAY  2  ,  MATT  C.  ESTEP  2,3  ,  AND  ZACK  E.  MURRELL  2   2 Department of Biology, Appalachian State University, 572 Rivers Street, Boone, North Carolina 28608 USA  •  Premise of the study: Twenty microsatellite loci were developed for the federally threatened species  Hexastylis nanifl ora (Aris-tolochiaceae) to examine genetic diversity and to distinguish this species from co-occurring congeners,  H. heterophylla and  H. minor .  •  Methods and Results: Next-generation sequencing approaches were used to identify microsatellite loci and design primers. One hundred fi fty-two primer pairs were screened for repeatability, and 20 of these were further characterized for polymorphism.In  H. nanifl ora , the number of alleles identifi ed for polymorphic loci ranged from two to 23 (mean ~8.8), with a mean hetero-zygosity of 0.39. •  Conclusions: These 16 polymorphic primers for  H. nanifl ora will be useful tools in species identifi cation and quantifying ge-netic diversity within the genus. Key words: Aristolochiaceae;  Asarum ;  Hexastylis ;  Hexastylis nanifl ora ; hybrid; microsatellite markers.2 of 3 Applications in Plant Sciences  2015  3 ( 7 ): 1500033  Hamstead et al.— Hexastylis nanifl ora microsatellites  doi:10.3732/apps.1500033 http://www.bioone.org/loi/apps Sixteen of the primer pairs tested were polymorphic, with the number of alleles ranging from two to 23 (mean ~8.8) in  H. nanifl ora , two to nine (mean ~4.9) in  H. minor , and one to 14 (mean ~6.1) in  H. heterophylla ( Table 2 ). Ex-cessive homozygosity was identifi ed at several of the loci in all three species, and locus Hn00567 was monomorphic in  H. heterophylla . A total of 52 private alleles were identifi ed in one of the three species, mostly at low frequencies (<0.05). Three of these private alleles in  H. nanifl ora (Hn7116 [422 bp], Hn01135 [300 bp], and Hn00304 [179 bp]), one in  H. minor (Hn00252 [224 bp]), and one in  H. heterophylla (Hn00002 [297 bp]) were identifi ed with a frequency greater than 10%, and these can be diagnostic in species identifi ca-tion when morphological characters are unavailable.  CONCLUSIONS  Sixteen polymorphic microsatellite markers were devel-oped for  H. nanifl ora , and these primers also amplify in two other species of  Hexastylis ( H. heterophylla and  H. minor ). These markers provide a means to assess genetic diversity and to assist in circumscription of the three species in the  H.  heterophylla complex. This provides the fi rst opportunity to examine species boundaries and hybrids in the complex with molecular tools; application of these tools should lead to a of GoTaq Flexi DNA Polymerase, and ~20 ng of DNA (Promega, Madison, Wisconsin, USA). PCR was completed using a touchdown thermal cycling pro-gram on a Techne TC-5000 Thermal Cycler (Bibby Scientifi c Limited, Stone, Staffordshire, United Kingdom) encompassing a 13 ° C span of annealing tem-peratures from 68 ° C to 55 ° C. Initial denaturation was at 94 ° C for 5 min, 13 cycles at 94 ° C for 45 s, touchdown for 2 min, and 72 ° C for 1 min; followed by 24 cycles at 94 ° C for 45 s, 55 ° C for 1 min, and 72 ° C for 1 min; followed by a fi nal extension at 72 ° C for 5 min. The PCR products were examined on a 1% agarose gel and scored for presence or absence of an appropriately sized PCR product. Twenty primer pairs produced repeatable results across all three spe-cies ( Table 1 ) . These were further screened for polymorphism on a total of 68 individuals, including 44  H. nanifl ora , 10  H. minor , and 14  H. heterophylla (Appendix 1).  Polymorphism screening PCR reaction conditions were the same as above, except the forward primer concentration was reduced to 0.25  μ M, and 0.25  μ M of an M13 primer (5 ′ -CACGACGTTGTAAAACGAC-3 ′ ), labeled with FAM, VIC, NED, or PET (Life Technologies), was added to the reaction. PCR prod-ucts labeled with different fl uorescent dyes were then pseudo-multiplexed, and 2  μ L of the combined reactions were submitted for genotyping on an ABI 3730 DNA sequencer using a GeneScan 500 LIZ Size Standard (Life Technologies). Resulting chromatograms were visualized and scored using the software pack-age Geneious Version 7 (Biomatters Ltd., Auckland, New Zealand). The result-ing genotypic data were then analyzed with GenAlEx version 6.5 ( Peakall and Smouse, 2006 ,  2012 ) to obtain standard descriptive statistics and to test for deviations from Hardy–Weinberg equilibrium assumptions ( Table 2 ) .  TABLE 1. Characteristics of 20 microsatellite primer pairs developed for  Hexastylis . Locus Primer sequences (5 ′ –3 ′ ) a Fluorescent dye Repeat motif  T a ( ° C) Allele size range (bp) GenBank accession no.Hn00002  F: AAGTCTTTCCACCAATAACACCG FAM (AAC) 5 60.51 297–306 KM242087 R: ATGCCTTGAGTCAACATGCTTTG Hn00011  F: CCAGTCTTAGTTACAAGATGCCG PET (AAC) 8 59.73 229–269 KM242088 R: TCGATACTGTGATCAAAGCCAAG Hn00014  F: GAGATTTGATCAGCGGTTTGAAC NED (ACC) 7 59.37 265–274 KM242089 R: GGGCAGTCAGAGTCATTTATCTC Hn00147  F: GGTAAAGCTAACATCCGACTGTG VIC (AGAT) 5 59.69 217–241 KJ619759 R: AAGGGTAGCTATAAGTTGGTTGC Hn00167  F: AGATGAGATTGTACATGTGAAACG FAM (AAG) 5 58.91 160 (M) KM242090 R: GTATTCTAACAACTACTGCTCCCG Hn00193  F: ATGTGAGATCAGTAGGAGACGAG PET (AAG) 14 59.82 337–369 KM242091 R: TTTGGGTGGATAATGGCTTTCTG Hn00197  F: CGGTCACACAGGACCATAGTAC VIC (ACT) 12 60.74 242–272 KM024991 R: CTCGGCGTCTAGACAGGTTATAG Hn00236  F: AGGAGGTTTGGGAGCATTATTTG FAM (ACC) 5 59.82 219 (M) KM242094 R: GCCTGTCAAACATCCTATGACTC Hn00252  F: AGGCATACAGAGGGCACATATAG NED (AAC) 7 59.58 221–241 KM242095 R: AAGAATGTTGAGAAGCTGCTTTG Hn00304  F: CCACTCCACTCCTTAATATAGAGC VIC (AAG) 10 58.97 179–205 KM024990 R: AATGTGGAGGAATCTGAGAACAC Hn00366  F: TGAATATACCAGTGCACAAACCC VIC (AC)6 59.39 162 (M) KM242098 R: CGATTCCTCTTCCGATCATAGTC Hn00567  F: ACTCTACCTCTCAATTCCACTCC FAM (ACC) 5 59.64 213–239 KM242100 R: GCGTGAAATAATATGGCCAATGG Hn00855  F: GAGAACGAGAGAGTACCGCAAC NED (AGAT) 8 61.52 276–346 KJ619760 R: ATGCCATATCAGCCGTCTACAAC Hn00955  F: CTTAGAGGTGGTAGGAAGGAGTC VIC (AAT) 13 59.77 366–429 KJ619751 R: GCAATGAACTCTAAATGGAATGGC Hn01096  F: CATGATAGCTACCTGGGATGATG FAM (AAG) 21 58.76 252 (M) KM242103 R: TTCGCTAATTTCATGCTTTCCTC Hn01135  F: TTCAGGCTGCAAACTATCTGAAC PET (ACC) 11 59.3 278–312 KM024992 R: TTCAGCAACCAACACTCATTTAC Hn1825  F: TGATGATGAAATGCTCCACTCAC FAM (AAC) 22 60.42 236–284 KM024993 R: AGACAAGACTGGATGGAGGTTTG Hn4600  F: GAGAGAACCGGTGAATCAAGTTG FAM (AAAG) 5 60.36 304–370 KM024994 R: AAAGTAGCAATCAGAATTCGGGC Hn7116  F: CTGATACCATGTGACAATGGAGG NED (AAGGAG) 5 59.7 422–451 KM024995 R: GTCATGATATTGGGCCTTCGTAG Hn12441  F: TCCATCGTACAAGGTCGTCTATG PET (AGGG) 5 60.14 164–183 KM024989 R: GAAGTCGAACCAAGGTCAATAGG  Note : M = monomorphic;  T a = annealing temperature.  a All forward primers also contain an M13 tag (5 ′ -CACGACGTTGTAAAACGAC-3 ′ ) on their 5 ′ end to allow fl uorescent labeling of PCR products.  Applications in Plant Sciences  2015  3 ( 7 ): 1500033  Hamstead et al.— Hexastylis nanifl ora microsatellites  doi:10.3732/apps.1500033 3 of 3http://www.bioone.org/loi/appsreassessment of distributions and hybrid zones. These mark-ers will also be valuable tools for vegetative identifi cation of new  Hexastylis populations when fl owers are unavailable. These primers may also be useful in other species of  Hexa-stylis and  Asarum .  LITERATURE CITED  BLOMQUIST ,  H. L.  1957 .   A revision of  Hexastylis of North America.  Brittonia  8 :  255 – 281 .   FAIRCLOTH ,  B. C.  2008 .   MSATCOMMANDER: Detection of micro-satellite repeat arrays and automated, locus-specifi c primer design.  Molecular Ecology Resources  8 :  92 – 94 .   GADDY ,  L.  1987 .   A review of the taxonomy and biogeography of  Hexastylis (Aristolochiaceae).  Castanea  52 :  186 – 196 .  NIEDENBERGER ,  B. A.  2010 .  Molecular phylogeny and comparative pol-len morphology of the genus  Hexastylis (Aristolochiaceae). Master’s thesis, Appalachian State University, Boone, North Carolina, USA.  PEAKALL ,  R. , AND  P. E.  SMOUSE .  2006 .   GenAlEx 6: Genetic analysis in Excel. Population genetic software for teaching and research.  Molecular Ecology Notes  6 :  288 – 295 .   PEAKALL ,  R. , AND  P. E.  SMOUSE .  2012 .   GenAlEx 6.5: Genetic analysis in Excel. Population genetic software for teaching and research—an up-date.  Bioinformatics (Oxford, England)  28 :  2537 – 2539 .   SOLTIS ,  D. E.  1984 .   Karyotypes of species of  Asarum and  Hexastylis (Aristolochiaceae).  Systematic Botany  9 :  490 – 493 .   SUGAWARA ,  T.  1981 .   Taxonomic studies of  Asarum sensu lato .  Botanical Magazine = Shokubutsu-gaku-zasshi  95 ( 3 ):  295 – 302 .   TABLE 2. Standard descriptive statistics for 16 polymorphic microsatellite loci in three species of  Hexastylis .  H. nanifl ora ( N = 44)  H. minor ( N = 10)  H. heterophylla ( N = 14)Locus  A  H o  H e HWE a  A  H o  H e HWE a  A  H o  H e HWE a Hn00002 2 0.421 0.494 n.s. 3 0.167 0.292 ** 3 0.200 0.540 **Hn00011 10 0.541 0.701 *** 6 0.333 0.750 n.s. 4 0.727 0.533 n.s.Hn00014 4 0.400 0.469 n.s. 3 0.429 0.663 n.s. 2 0.182 0.165 n.s.Hn00147 13 0.649 0.781 ** 7 0.714 0.786 n.s. 11 0.583 0.872 ***Hn00193 11 0.658 0.803 n.s. 5 0.400 0.760 n.s. 7 0.889 0.741 n.s.Hn00197 10 0.216 0.843 *** 9 0.700 0.860 n.s. 9 0.471 0.875 **Hn00252 3 0.289 0.440 n.s. 2 0.000 0.278 * 2 0.364 0.397 n.s.Hn00304 9 0.659 0.779 n.s. 6 0.556 0.765 n.s. 7 0.571 0.801 n.s.Hn00567 2 0.049 0.048 n.s. 2 0.222 0.198 n.s. 1 0.000 0.000 MHn00855 23 0.674 0.930 *** 6 0.556 0.765 n.s. 14 0.750 0.906 n.s.Hn00955 17 0.537 0.897 *** 7 0.375 0.750 ** 11 0.571 0.865 n.s.Hn01135 9 0.585 0.747 n.s. 6 0.429 0.776 n.s. 6 0.385 0.627 n.s.Hn1825 13 0.818 0.871 n.s. 8 0.750 0.820 n.s. 10 0.786 0.878 n.s.Hn4600 2 0.385 0.393 n.s. 2 0.250 0.219 n.s. 2 0.500 0.486 n.s.Hn7116 9 0.585 0.717 ** 4 0.625 0.680 n.s. 5 0.462 0.533 n.s.Hn12441 4 0.159 0.290 * 3 0.571 0.503 n.s. 3 0.556 0.426 n.s.Mean 8.81 0.388 0.523 4.937 0.346 0.501 6.062 0.410 0.492 Note :  A = number of alleles;  H e = expected heterozygosity;  H o = observed heterozygosity; HWE = Hardy–Weinberg equilibrium.  a Asterisks indicate signifi cant deviation from Hardy–Weinberg equilibrium (* P < 0.05, ** P < 0.01, *** P < 0.001); M = monomorphic; n.s. = not signifi cant .  APPENDIX 1 . Location and sampling information for  Hexastylis individuals used in this study. Species Herbarium accession no. a Geographic coordinates b Elevation (m) State (Country) County  N Latitude ( ° N) Longitude ( ° W) H. heterophylla 28952 36.00152 −81.01013 270 NC (USA) Alexander 3 H. heterophylla 28954 35.85079 −81.47797 337 NC (USA) Caldwell 7 H. heterophylla 28947 35.21389 −82.23407 N/A NC (USA) Polk 2 H. heterophylla 28950 36.03405 −81.06168 385 NC (USA) Wilkes 2 H. minor 28963 35.24580 −81.43860 273 NC (USA) Cleveland 5 H. minor 28965 36.05922 −78.96552 144 NC (USA) Durham 5 H. nanifl ora 28964 N/A N/A 293 NC (USA) Alexander 3 H. nanifl ora 28978 N/A N/A 337 NC (USA) Burke 5 H. nanifl ora 28973 N/A N/A 279 NC (USA) Catawba 11 H. nanifl ora 28975 N/A N/A 219 NC (USA) Cleveland 3 H. nanifl ora 29019 N/A N/A 237 NC (USA) Iredell 3 H. nanifl ora 28974 N/A N/A 336 NC (USA) Polk 3 H. nanifl ora 28988 N/A N/A 282 NC (USA) Rutherford 9 H. nanifl ora 28972 N/A N/A 287 SC (USA) Cherokee 3 H. nanifl ora 28987 N/A N/A 244 SC (USA) Spartanburg 4 Note :  N = number of individuals; N/A = not available; NC = North Carolina; SC = South Carolina.  a All herbarium accession numbers refer to voucher specimens deposited in the Appalachian State University Herbarium (BOON).  b Geographic coordinates for federally listed species are not included. 

Sixteen Polymorphic Microsatellite Markers For A Federally Threatened Species, Hexastylis Naniflora (Aristolochiaceae), And Co-Occurring Congeners

http://libres.uncg.edu/ir/asu/f/Estep_Matt_2015_Sixteen_polymorphic_microsateliate_orig.pdf

Sixteen Polymorphic Microsateliate Markers For A Federally Threatened Species, Hexastylis Naniflora (Aristolochiaceae), And Co-Occurring Congeners

Abstract

Similar works

Full text

Available Versions

The University of North Carolina at Greensboro