Cytochrome p450s (cyp450s) are a family of structurally related proteins, with diverse functions, including steroid synthesis and breakdown of toxins. This paper reports the full-length sequence of a novel cyp450 gene, the first to be isolated from the tropical freshwater snail Biomphalaria glabrata, an important intermediate host of Schistosoma mansoni. The nucleotide sequence is 2291 bp with a predicted amino acid sequence of 584aa. The sequence demonstrates conserved cyp450 structural motifs, but is sufficiently different from previously reported cyp450 sequences to be given a new classification, CYP320A1. Initially identified as down-regulated in partially resistant snails in response to S. mansoni infection, amplification of this gene using RT-PCR in both totally resistant or susceptible snail lines when exposed to infection, and all tissues examined, suggests ubiquitous expression. Characterization of the first cyp450 from B. glabrata is significant in understanding the evolution of these metabolically important proteins

Altschul SF

Anne E Lockyer

Brown DJ

Catherine S Jones

Chang GWM

Chaty S

David Rollinson

Gough J

Leslie R Noble

Lockyer AE

Madera M

Nelson DR

Omura T

Sambrook J

Snyder MJ

Teunissen Y

Memórias do Instituto Oswaldo Cruz

English

Crossref

Isolation and characterization of the full-length cDNA encoding a member of a novel cytochrome p450 family (CYP320A1) from the tropical freshwater snail, Biomphalaria glabrata, intermediate host for Schistosoma mansoni

Lockyer, AE

Noble, LR

Rollinson, D

Jones, CS

Brunel University Research Archive

259Mem Inst Oswaldo Cruz, Rio de Janeiro, Vol. 100(3): 259-262, May 2005Isolation and characterization of the full-length cDNA encoding amember of a novel cytochrome p450 family (CYP320A1) from thetropical freshwater snail, Biomphalaria glabrata, intermediatehost for Schistosoma mansoniAnne E Lockyer, Leslie R Noble*, David Rollinson, Catherine S Jones*/+Wolfson Wellcome Biomedical Laboratory, The Natural History Museum, London, UK *School of Biological Sciences,Aberdeen University, Tillydrone Avenue, Aberdeen. AB24 2TZ, ScotlandCytochrome p450s (cyp450s) are a family of structurally related proteins, with diverse functions, includingsteroid synthesis and breakdown of toxins. This paper reports the full-length sequence of a novel cyp450 gene, thefirst to be isolated from the tropical freshwater snail  Biomphalaria glabrata, an important intermediate host ofSchistosoma mansoni. The nucleotide sequence is 2291 bp with a predicted amino acid sequence of 584aa. Thesequence demonstrates conserved cyp450 structural motifs, but is sufficiently different from previously reportedcyp450 sequences to be given a new classification, CYP320A1. Initially identified as down-regulated in partiallyresistant snails in response to S. mansoni infection, amplification of this gene using RT-PCR in both totally resistantor susceptible snail lines when exposed to infection, and all tissues examined, suggests ubiquitous expression.Characterization of the first cyp450 from B. glabrata is significant in understanding the evolution of these metaboli-cally important proteins.Key words: cytochrome p450 - Biomphalaria glabrata - Schistosoma mansoni - RACE -  cyp450 - CYP320A1The cytochrome p450 (cyp450) superfamily of proteinscontains a large number of heme-containing mono-oxygenases. These proteins oxidize a variety of structur-ally unrelated compounds including steroids, fatty acidsand xenobiotics (for reviews see Nelson et al. 1996, Chang& Kam 1999, Omura 1999). The cyp450s have been classi-fied according to sequence similarity into families (Nelsonet al. 1996) and a higher order of classification of ‘clans’(Nelson 1998). A large number of these proteins have beenidentified in individual species, particularly those for whichthe genome is totally or nearly sequenced. For examplethe ‘superfamily’ website genome assignments [http://supfam.mrc-lmb.cam.ac.uk: (Gough et al. 2001, Madera etal. 2004)] has identified 266 cytochrome p450 proteins inArabidopsis thaliana, 99 in Drosophila melanogaster and130 in Anopheles gambiae, while in humans, mouse andrat, 104, 164, and 127 cyp450s respectively, have so farbeen identified. Despite the large numbers found in theseorganisms, for molluscs only 7 cyp450 genes or sequencefragments are currently submitted to GenBANK, includ-ing CYP10 from Lymnea stagnalis (Teunissen et al. 1992),CYP30 from the clam, Mercenaria mercenaria (Brown etal. 1998) and CYP4 fragments from Mytilus gallo-provincialis and Haliotis rufescens (Snyder 1998).Financial support: The Wellcome Trust, The Biological andBiotechnology Research Council (Advanced fellowship to CSJ,1/AF09056)+Corresponding author.  E-mail: c.s.jones@abdn.ac.ukReceived 18 November 2004Accepted 28 March 2005A sequence fragment with homology to the cyp450superfamily was isolated from the freshwater tropical snailBiomphalaria glabrata (Lockyer et al. 2000), which is anintermediate host to Schistosoma mansoni, the causativeagent of human intestinal schistosomiasis. The identified241 bp sequence fragment, designated BgCYP, did notprovide enough information to allow the classification ofthis sequence to a family of cytochrome p450 protein se-quences (Lockyer et al. 2000) but it was demonstratedthat it was expressed in ovotestis, mantle and nephridiumtissue from snails that were 70% resistant to schistosomeinfection. This paper reports the full-length sequence ofthe first cytochrome p450 to be identified from B. glabrata,and expression analysis of this gene in snails differing intheir susceptibility to schistosome infection.MATERIALS AND METHODS Snail material - Three strains of B. glabrata withdifferent susceptibilities to schistosome infection wereinvestigated. A partially resistant strain (NHM accessionnumber 1778), from which the BgCYP gene fragment wasinitially identified, was used to isolate the full-length se-quence. Other strains used were a 100% resistant strain,(NHM accession number 1981) and a susceptible strain(NHM accession number 1742). Adult snails were swiftlykilled by cutting off the head/foot through the shell andpreserved in RNAlaterTM (Ambion).RNA isolation - Total RNA was extracted from ovotes-tis, mantle and brain tissue, using SV total isolation sys-tem (Promega) according to the manufacturers instruc-tions. This kit includes a DNAse treatment step to re-move contaminating genomic DNA. Poly (A) RNA wasextracted from total RNA with RNeasy extraction kit(Qiagen) according to the protocol supplied with the kit.260 B. glabrata cyp450 gene characterization • Anne E Lockyer et al.3’RACE PCR - 1 µg total RNA from B. glabrata strain1778, was reverse transcribed in a 20 µl reaction contain-ing 1 × RT buffer (Promega), 5 µM oligo dTAP (TGACTCGAGTCGACATCGAT20), 1.25 mM dNTPs (Bioline),40 U RNAsin (Promega) and 200 U MMLV-RT (moloneymurine leukemia virus reverse transcriptase, Promega). TheRNA and primer mix was denatured at 70°C and cooled onice, prior to adding the rest of the reaction components.This was incubated at 22°C for 10 min, 42°C for 60 min,then 70°C for 10 min to inactivate the RT. Controls withoutreverse transcriptase were performed and tested with B.glabrata specific actin primers that span an intron tocheck for contaminating genomic DNA (Lockyer et al.2000). The synthesized cDNA was used for a 25 µl PCRcontaining 1 µl cDNA, 1× PCR buffer (Bioline), 2.5 mMMgCl2, 0.2 mM dNTPs and 0.5 µM of adaptor primer (AP:TCGATGTCGACTCGAGTCA, complementary to oligodTAP) and 0.5 µM 19F (a specific internal primer:GCTGCGGTCACTCCATCGTC). The reaction was heatedto 95°C and 1U diluted Taq polymerase (Bioline) addedthrough the mineral oil. Reaction conditions were 35 cyclesof 30 sec at 95°C, 1 min at 58°C and 3 min at 72°C, followedby 5 min at 72°C.5'RACE - 5 µg poly (A) RNA from B. glabrata strain1778 was reverse transcribed (as above) using specificprimers (0.1 µM). Three rounds of 5' RACE were requiredto recover the full-length cDNA. Primers used for firststrand cDNA synthesis were (i) 19R: AGGGTCAAGGTAAAATCTGGG, (ii) 19R2: CTGCCCATTACAAAAGTCCC, and (iii) BgCYPR5: ATGGACTTTTTGTGTTCGTTG. Controls with no RT or with an oligo dT primerwere run simultaneously and checked using actin primersas above. cDNA was cleaned (Qiaquick PCR purificationkit, Qiagen) and tailed with dATPs using terminaldeoxynucleotidyl transferase (TdT). This 20 µl reactioncontained 14 µl cleaned cDNA, denatured for 3 min at94°C first, 1 × TdT reaction buffer (Promega), 0.8 mM dATPand 20 U TdT (Promega) and was incubated on ice for 60min, then 10 min at 37°C and 10 min at 70°C. 1 µl tailedcDNA was amplified with the oligo dTAP, AP and specificnested primers: (i) 19R2: CTGCCCATTACAAAAGTCCC,(ii) BgcypR5: ATGGACTTTTTGTGTTCGTTG, and (iii)BgCYP3R: GTTCACCTTTCTTCCCCTCC and a secondnested primer, BgCYPR2: AGCGTGTTCAGGTAGAGGAG.25 µl reaction contained cDNA, 1x PCR buffer, 2.5 µMMgCl2, 0.5 µM each of AP and the specific primer, 0.08µM oligo dTAP and 0.2 mM dNTP. The reaction was heatedto 94°C for 5 min and cooled to 80°C. 1 U Taq polymerasewas added through the mineral oil. Reaction conditionswere 1 min at 94°C, 2 min at 48°C and 40 min at 72°C, then30 cycles of 1 min at 94°C, 1 min at 56-60°C and 3 min at72°C followed by 15 min at 72°C. The annealing tempera-ture for the cycling was varied between 56-60°C depend-ing on the specific nested primer. Simultaneous controlsused untailed cDNA.Cloning and sequencing - RACE PCR products wereanalysed on electrophoresis gels and excised fragmentspurified using QIAEX II Agarose gel extraction kit(Qiagen). These were reamplified if necessary, ligated intopGEM-T easy vector (Promega) and used to transformJM109 cells (Promega). Positive clones were sequencedon both strands from the purified plasmid (WizardMiniprep, Promega) using the SequiTherm EXCELTM IIDNA sequencing kit-LC (Cambio, UK) according to theprotocol supplied with the kit and run on a LICORLongReadIR automatic sequencer (MWG Biotech, UK).Sequences were analysed using e-seqTM (version 1.0)and aligned using Align IR (version 1.2).Sequence analysis - The full-length sequence was com-pared to GenBank using BlastN and BlastP (Altschul etal. 1990). It was translated using proteomics tools at theEXPASY website (http://ca.expasy.org/sprot/). Proteinalignments with the closest Blast matches were made byeye.Northern blotting - 5 µg poly (A) RNA from B. glabrata1778 strain ovotestis and 5 µg of RNA marker (Promega)were electrophoresed on a denaturing agarose gel(Sambrook et al. 1989) and transferred onto Hybond Nmembrane (Amersham) according to the manufacturer’sinstructions. A 853 bp PCR product was amplified for useas a probe using specific primers 19R: AGGGTCAAGGTAAAATCTGGG and CYPF: TATTGCGAGATCCACTGTCC. 10 µl PCR contained 1 µl cDNA, 1× PCR buffer(Bioline), 2.5 mM MgCl2, 0.2 mM dNTPs and 0.5 µM eachprimer. Reaction conditions were 35 cycles of 30 s at 95°C,30 s at 60°C and 30 s at 72°C, followed by 5 min at 72°C.This fragment was cleaned using Qiaquick columns(Qiagen), labelled with [32P]-dATP (Prime-a-gene kit,Promega) and hybridized overnight to the membrane. Thehybridized labelled probe was visualized with autorad-iography for 16-48 h at –80°C with an intensifying screen.Semi-quantitative RT-PCR - 1 µg total RNA, extractedfrom mantle, brain and ovotestis dissected from resistant1981 and susceptible 1742 snail lines, was reverse tran-scribed as described above, but using an anchored oligodT12VN primer. RT-PCR in duplicate, was performed us-ing specific primers, CYPF: TATTGCGAGATCCACTGTCC and BgcypR5: ATGGACTTTTTGTG TTCGTTG. 10µl PCRs contained 1 µl cDNA, 1× PCR buffer (Bioline), 2.5mM MgCl2, 0.2 mM dNTPs and 0.5 µM each primer. Reac-tion conditions were 35 cycles of 30 s at 95°C, 30 s at 58°Cand 30 s at 72°C, followed by 5 min at 72°C. The number ofcycles during the PCR was limited to the linear phase wherethe amount PCR product is proportional to the amount ofstarting material. Semi-quantitative RT-PCR using actinprimers under the same conditions, but limiting the num-ber of cycles to 25 was carried out for comparison to thespecific products.RESULTSThe full-length sequence of the B. glabrata cyp450(BgCYP) gene was obtained using 3' and 5' RACE. Prim-ers were designed from the original sequence fragment.Four overlapping fragments, amplified using 3' RACE andthree rounds of 5' RACE, were sequenced and aligned.The length of the full sequence was 2291 bp. A northernblot (Fig. 1) using poly (A) RNA extracted from ovotestisof the partially resistant strain, the tissue from which thesequence fragment was originally isolated, showed onlyone size of transcript identified by the BgCYP sequence,which was estimated to be approximately 2100 bp.261Mem Inst Oswaldo Cruz, Rio de Janeiro, Vol. 100(3), May 2005The full length sequence has a long open reading frame(ORF) of 1752 bp coding for a predicted protein of 584amino acids with 195 bp 5' untranslated region (UTR) and344 bp 3' UTR (GenBANK accession number AY922309).The 3' UTR contains a polyadenylation signal. The pre-dicted start Met residue is encoded by the first ATG inframe with the long ORF. A BLASTP search using the fulllength BgCYP predicted peptide sequence identifiedcyp450 domains from both CYP2 and CYP17 families aswell as many other CLAN2 cyp450s. Comparison withthese cyp450s from Clan2 shows that the predicted pro-tein for BgCYP contains the cyp450 family signature in-cluding a highly conserved cysteine (Cys529) residue,which binds a heme molecule (Fig. 2). The predicted pep-tide sequence was submitted to the cytochrome p450 no-menclature committee and named CYP320A1, with a suffi-ciently distinct amino acid sequence to be the first pro-tein in a novel group of cytochrome p450 proteins, whichfall into the CLAN 2 (D. Nelson, personal communica-tion), confirming our previous conclusion (Lockyer et al.2000).The protein sequence of the B. glabrata cytochromep450 demonstrates that it shows less than 40% identity toany known cyp450 family and therefore it has been classi-fied as a novel family. As the first member of the CYP320family, the function of this protein remains unknown andcannot be hypothesized on the basis of sequence homol-ogy to other, more characterized, cyp450s.RT-PCR was performed on two snail lines, a 100% re-sistant strain and a susceptible strain and showed thatthe gene is expressed in both these snail lines, in theovotestis, mantle and brain tissue (Fig. 3). Semi-quantita-tive RT-PCR using actin primers mirrors that of CYP320A1,suggesting no large difference in the level of expressionbetween the tissues or strains investigated.DISCUSSIONThe full-length sequence of BgCYP has enabled us todetermine that it codes for a novel cytochrome p450 andthe RT-PCR result shows that it is expressed in all tissuesexamined. This sequence represents the first cytochromep450 to be identified from B. glabrata and only the 8thsequence from a mollusc. However, cytochrome p450 ac-tivity has been examined as a biomarker in response toxenobiotic exposures such as pollution both by biochemi-cal assay in several marine molluscs (reviewed by Snyder2000) and by RT-PCR in, for example, the freshwater mus-sel Unio tumidus (Chaty et al. 2004).The gene was initially identified as down-regulated inpartially resistant snails in response to schistosome in-fection (Lockyer et al. 2000). However this has not beenobserved in either totally resistant or susceptible snailslines exposed to infection (results not shown). Thereforeit appears that BgCYP is not intimately connected withthe passage of schistosome infection through the snailintermediate host. However the characterization of the firstcyp450 from B. glabrata is significant in understandingFig. 1: Northern blot with poly(A) RNA extracted from the ovotes-tis (O/T) of 70% resistant strain of Biomphalaria glabrata, probedwith BgCYP. M: RNA marker (Promega).Fig. 2: comparison with the heme-binding region of other cyp450 sequences in clan 2. Amino acids shared between the Biomphalariaglabrata cyp450 (CYP320A1) and other cyp450s are shaded. The cysteine residue associated with heme-binding is shaded darker grey.262 B. glabrata cyp450 gene characterization • Anne E Lockyer et al.the evolution of these metabolically important proteins. Itseems likely that more cyp450 genes will be identified inB. glabrata, given that many have been identified in otherorganisms, and elucidating the role that they play in snailphysiology may enable a better understanding of the evo-lution and diversity of function of these proteins.ACKNOWLEDGEMENTSTo Sarah Martin and Mike Anderson at NHM for snailculture and Dr Fred Lewis, Biomedical Research Institute,Rockville, MD, US, for providing the NHM with the resistantsnail line.REFERENCESAltschul SF, Gish W, Miller W, Myers EW, Lipman DJ 1990.Basic local alignment search tool. J Mol Biol 215: 403-410.Brown DJ, Clark GC, Van Beneden RJ 1998. A new cyto-chrome P450 (CYP30) family identified in the clam,Mercenaria mercenaria. Comp Biochem Physiol C-Pharmacol Toxicol Endocrinol 121: 351-360.Chang GWM, Kam PCA 1999. The physiological and pharma-cological roles of cytochrome P450 isoenzymes. Anaesthe-sia 54: 42-50.Chaty S, Rodius F, Vasseur P 2004. A comparative study of theexpression of CYP1A and CYP4 genes in aquatic inverte-brates (freshwater mussel, Unio tumidus) and vertebrate(rainbow trout, Oncorhynchus mykiss). Aquatic Toxicol 69:81-93.Gough J, Karplus K, Hughey R, Chothia C 2001. Assignmentof homology to genome sequences using a library of hiddenMarkov models that represent all proteins of known struc-ture. J Mol Biol 313: 903-919.Lockyer AE, Jones CS, Noble LR, Rollinson D 2000. Use ofdifferential display to detect changes in gene expression inthe intermediate snail host Biomphalaria glabrata uponinfection with Schistosoma mansoni. Parasitology 120: 399-407.Madera M, Vogel C, Kummerfeld SK, Chothia C, Gough J 2004.The SUPERFAMILY database in 2004: additions and im-provements. Nuc Acid Res 32: D235-D239.Nelson DR 1998. Metazoan cytochrome P450 evolution. CompBiochem Physiol C-Pharmacol Toxicol Endocrinol 121:15-22.Nelson DR, Koymans L, Kamataki T, Stegeman JJ, FeyereisenR, Waxman DJ, Waterman MR, Gotoh O, Coon MJ,Estabrook RW, Gunsalus IC, Nebert DW 1996. P450 su-perfamily: Update on new sequences, gene mapping, acces-sion numbers and nomenclature. Pharmacogenetics 6:1-42.Omura T 1999. Forty years of cytochrome P450. BiochemBiophys Res Com 266: 690-698.Sambrook J, Fritsch EF, Maniatis T 1989. Molecular Cloning.A Laboratory Manual, Cold Spring Harbor LaboratoryPress, Cold Spring Harbor.Snyder MJ 1998. Cytochrome P450 enzymes belonging to theCYP4 family from marine invertebrates. Biochem BiophysRes Com 249: 187-190.Snyder MJ 2000. Cytochrome p450 enzymes in aquatic inver-tebrates: recent advances and future directions. AquaticToxicol 48: 529-547.Teunissen Y, Geraerts WPM, Vanheerikhuizen H, Planta RJ,Joosse J 1992. Molecular cloning of a cDNA encoding amember of a novel cytochrome P450 family in the molluscLymnaea stagnalis. J Biochem 112: 249-252.Fig. 3: RT-PCR performed on two snail lines (100% resistant strain and a susceptible strain) shows CYP320A1 is expressed in both snaillines and in all tissues examined (ovotestis, mantle and brain). RT-PCR using a) Biomphalaria glabrata CYP320A1 specific primers (435bp) and b) B. glabrata actin primers (414 bp). cDNA samples were from lanes - 1-2, 100% resistant mantle; 3-4, susceptible mantle; 5-6,100% resistant brain; 7-8, susceptible brain; 9-10, 100% resistant ovotestis; 11-12, susceptible ovotestis; 13, No DNA control, NC and 14,70% resistant ovotestis (positive control, PC). A fragment of approximately 50 bp present in all lanes (1-14) in Fig. 3a) is primer-dimer.M. DNA size standard (Hyperladder IV Bioline).

Directory of Open Access Journals

Cytochrome p450s (cyp450s) are a family of structurally related
proteins, with diverse functions, including steroid synthesis and
breakdown of toxins. This paper reports the full-length sequence of a
novel cyp450 gene, the first to be isolated from the tropical
freshwater snail Biomphalaria glabrata    , an important
intermediate host of Schistosoma mansoni    . The nucleotide
sequence is 2291 bp with a predicted amino acid sequence of 584aa. The
sequence demonstrates conserved cyp450 structural motifs, but is
sufficiently different from previously reported cyp450 sequences to be
given a new classification, CYP320A1. Initially identified as
down-regulated in partially resistant snails in response to S. mansoni
infection, amplification of this gene using RT-PCR in both totally
resistant or susceptible snail lines when exposed to infection, and all
tissues examined, suggests ubiquitous expression. Characterization of
the first cyp450 from B. glabrata is significant in understanding the
evolution of these metabolically important proteins

Anne E. Lockyer

Leslie R. Noble

Catherine S. Jones

TSpace Repository

Isolation and characterization of the full-length cDNA encoding a member of a novel cytochrome p450 family (CYP320A1) from the tropical
freshwater snail, Biomphalaria glabrata, intermediate host for Schistosoma mansoni

Isolation and characterization of the full-length cDNA encoding a member of a novel cytochrome p450 family (CYP320A1) from the tropical freshwater snail, Biomphalaria glabrata, intermediate host for Schistosoma mansoni

Abstract

Similar works

Full text

Available Versions

Crossref

Brunel University Research Archive

Directory of Open Access Journals

TSpace Repository

Scientific Electronic Library Online - Brazil