Differences were detected in the gene expression of strains of E. histolytica using RNA (RAP-PCR) and DNA fingerprinting (RAPD). Analysis of the electrophoretic profiles of the gels revealed some polymorphic markers that could be used in the individual characterization of the strains. The 260 bands generated by using five different primers for RAP-PCR, as well as RAPD, were employed in the construction of dendograms. The dendogram obtained based on the RAPD products permitted the distinction of symptomatic and asymptomatic isolates, as well the correlation between the polymorphism exhibited and the virulence of the strains. The dendogram obtained for the RAP-PCR products did not show a correlation with the virulence of the strains but revealed a high degree of intraspecific transcriptional variability that could be related to other biological features, whether or not these are involved in the pathogenesis of amebiasis.Diferenças na expressão gênica de cepas de E. histolytica foram obtidas pelo "fingerprinting" de RNA (RAP-PCR) e DNA (RAPD). A análise do perfil eletroforético do gel revelou alguns marcadores polimórficos que poderiam ser usados na caracterização individual das cepas. As 260 bandas geradas pela utilização de cinco primers diferentes, tanto no RAP-PCR, quanto no RAPD foram empregadas na construção de dendogramas. O dendograma obtido com os produtos do RAPD permitiu a distinção das cepas isoladas de pacientes sintomáticos e assintomáticos, além de correlacionar o polimorfismo exibido com a virulência das mesmas. O dendograma obtido com os produtos do RAP-PCR não apresentou correlação com a virulência das cepas, mas revelou uma exuberante variabilidade transcricional intra-específica, que pode estar relacionada a outros caracteres biológicos envolvidos, ou não, na patogênese da amebíase

GOMES, Maria A.

PIRES, Edna M.

SILVA, Edward F.

SOUZA, Maria Betânia G.

VALLE, Paulo Renato

English

Diferenças na expressão gênica de cepas de E. histolytica foram obtidas pelo "fingerprinting" de RNA (RAP-PCR) e DNA (RAPD). A análise do perfil eletroforético do gel revelou alguns marcadores polimórficos que poderiam ser usados na caracterização individual das cepas. As 260 bandas geradas pela utilização de cinco primers diferentes, tanto no RAP-PCR, quanto no RAPD foram empregadas na construção de dendogramas. O dendograma obtido com os produtos do RAPD permitiu a distinção das cepas isoladas de pacientes sintomáticos e assintomáticos, além de correlacionar o polimorfismo exibido com a virulência das mesmas. O dendograma obtido com os produtos do RAP-PCR não apresentou correlação com a virulência das cepas, mas revelou uma exuberante variabilidade transcricional intra-específica, que pode estar relacionada a outros caracteres biológicos envolvidos, ou não, na patogênese da amebíase.Differences were detected in the gene expression of strains of E. histolytica using RNA (RAP-PCR) and DNA fingerprinting (RAPD). Analysis of the electrophoretic profiles of the gels revealed some polymorphic markers that could be used in the individual characterization of the strains. The 260 bands generated by using five different primers for RAP-PCR, as well as RAPD, were employed in the construction of dendograms. The dendogram obtained based on the RAPD products permitted the distinction of symptomatic and asymptomatic isolates, as well the correlation between the polymorphism exhibited and the virulence of the strains. The dendogram obtained for the RAP-PCR products did not show a correlation with the virulence of the strains but revealed a high degree of intraspecific transcriptional variability that could be related to other biological features, whether or not these are involved in the pathogenesis of amebiasis

Cadernos Espinosanos (E-Journal)

			 !	"""Departamento de Parasitologia, Instituto de Ciências Biológicas, Universidade Federal de Minas Gerais, Belo Horizonte, Minas Gerais, Brasil.Correspondence to: M.A. GOMES, Depto. Parasitologia, ICB-UFMG. Av. Antônio Carlos 6627, Pampulha, 31270-901 Belo Horizonte, MG, Brazil. e-mail: magomes@mono.icb.ufmg.brARBITRARILY PRIMED PCR FINGERPRINTING OF RNA AND DNA IN Entamoeba histolyticaPaulo Renato VALLE, Maria Betânia G. SOUZA, Edna M. PIRES, Edward F. SILVA & Maria A. GOMESSUMMARYDifferences were detected in the gene expression of strains of E. histolytica using RNA (RAP-PCR) and DNA fingerprinting(RAPD). Analysis of the electrophoretic profiles of the gels revealed some polymorphic markers that could be used in the individualcharacterization of the strains. The 260 bands generated by using five different primers for RAP-PCR, as well as RAPD, wereemployed in the construction of dendograms. The dendogram obtained based on the RAPD products permitted the distinction ofsymptomatic and asymptomatic isolates, as well the correlation between the polymorphism exhibited and the virulence of the strains.The dendogram obtained for the RAP-PCR products did not show a correlation with the virulence of the strains but revealed a highdegree of intraspecific transcriptional variability that could be related to other biological features, whether or not these are involved inthe pathogenesis of amebiasis.KEYWORDS: Entamoeba histolytica; Virulence; RAP-PCR; RAPD.INTRODUCTIONThe protozoan parasite Entamoeba histolytica, causative agent ofamebiasis, produces very varied clinical manifestations, ranging fromsevere symptomatic presentations involving hepatic abscess toasymptomatic cases. This diversity in manifestations of the disease canbe explained by the great variety of strains with different degrees ofvirulence. This variability of virulence is related to factors dependent onthe host, the parasite and the interaction between the two of them. Inrelation to the parasite, many molecules related to this function havealready been described1,2,3,5,7,8,9,12,13 and the mechanisms involved indestruction of the tissues elucidated to some extent. The process beginswith adherence of the trophozoite to the target cell and is followed bycellular lysis, which may be preceeded by phagocytosis. The proteinsthat act in the diverse stages of this process, which ends in the destructionof the host cell, are present in a differentiated form in the diverse isolatesof E. histolytica. Even so, the relationship between virulence of strainsand variability of proteins is still not clear. In this study we analysed thegene expression of some strains of E. histolytica showing differentdegrees of virulence through the RAP-PCR (RNA Arbitrarily Primed –PCR) technique21. This technique is carried out in two steps (cDNAsynthesis and PCR) and provides a “fingerprinting” of RNA, enablingnot only the identification of the products of gene expression, but alsothe intensity with which they are being transcribed. We can thus evaluatethe real influence of a determined gene on the virulence of the strain atthe moment of RNA extraction. We also analysed the DNA polymorphismof the strains in this study, using the RAPD (Randomly AmplifiedPolymorphic DNA) technique20, for comparison.MATERIALS AND METHODSStrains of Entamoeba histolyticaThe strains of E. histolytica, culture conditions and some biologicalcharacteristics of the strains are summarized in Table 1.Nucleic acid extractionAxenic samples of E. histolytica were obtained from a culture inexponential growth phase. The trophozoites were washed with PBS pH7.2, concentrated by centrifugation at 300 g for 10 min., counted andadjusted to 1 x 106 cells. Then, the DNA of these cells was digested withproteinase K, extracted with phenol/chloroform and precipitated withethanol14. The RNA was extracted by the TRIZOL method accordingto the manufacturer’s protocol (Life-Technologies).cDNA preparation and RAP-PCRFor cDNA synthesis we used the protocol described by WELSH etal. (1992)21 with some modifications. Each 1 g of RNA was heated at65 oC for 10 min. and the following reagents were added: 0.1 mM dNTPs,100 units of reverse transcriptase (Life-Technologies), 0.5 g of (oligodT), in a buffer that consisted of 50 mM Tris/HCl, pH 8.3, 50 mM KCl,3 mM MgCl2 and 10 mM DTT in a final reaction volume of 20 l. Thismixture was incubated at 37 oC for 1 hour and 1 g of the resultingcDNA was employed in the PCR reaction. In this reaction 0.2 mM ofdNTPs and 1.0 unit of Taq DNA polymerase (Cenbiot, RS, Brazil) wereVALLE, P.R.; SOUZA, M.B.G.; PIRES, E.M.; SILVA, E.F. & GOMES, M.A. - Arbitrarily primed PCR fingerprinting of RNA and DNA in Entamoeba histolytica. Rev. Inst. Med. trop. S.Paulo, 42(5): 249-253, 2000.used in a buffer that consisted of 10 mM Tris-HCl, pH 8.5, 50 mM KCland 1.5 mM MgCl2 in a final volume of 10 l. One micromol of fivedifferent arbitrary primers was used in each amplification reaction. Thesamples were submitted to 1 cycle of 95 oC for 1 min., 40 oC for 3 min.and 72 oC for 3 min., followed by 29 amplification cycles as follows: 95oC for 1 min., 55 oC for 1 min. and 72 oC for 2 min.RAPDOne nanogram of genomic DNA of each strain studied was used asa template for RAPD and as a control in the RAP-PCR reaction. Theamplification reaction followed the protocol described by STEINDELet al. (1993)16. Each 10 l of the reaction mixture contained 0.8 U ofTaq DNA polymerase (Cenbiot-RS-Brazil), 0.2 mM of dNTPs,1.5 mM of MgCl2, 50 mM of KCl, 10 mM of Tris-HCl at pH 8.5 and1.0 M of primer. The following five primers were used in the twotechniques:L1-5’a: 5’CGCTGGGAGCTGTAGACCGGAG,L2401: 5’AATATCCACTTGCAGATTCTAG,L15: 5’CTCCACCATTAGCACCCAAAGC,U2355: 5’GTGATGTGTGCATTCATCTCAT andgt11: 5’TTGACACCAGACCAACTGGTAATG.Five microliters of the PCR products were run in 5%polyacrylamide gel and stained with silver salts.Analysis of the RAP-PCR and RAPD dataThe data derived from the five primers, the DNA fragments (bands),were considered for analysis. The genetic distances between the strainswere calculated by LINK et al. method (1995)6 based on RAPD andRAP-PCR product. These distances were listed in two matrixes and usedto construct dendograms. The LINK et al. method (1995)6 provides thegenetic distance through the following mathematical model: GDxy =(Nx + Ny) / (Nx + Ny + Nxy) where Nx is the number of bands in linex and not in line y, Ny is the number of bands in line y and not in line x,and Nxy is the number of bands shared in lines x and y. Tree topologieswere established according to the clustering complete linkage methodwith the data presented on the matrixes. Once the complete linkagemethod works with cluster analysis, it considers the evolution rate asbeing the same for each strain, what makes the dendogram ultrameric.This means that the distance from the main root to the end of each branchis the same for each strain. The reason for using the complete linkagetype of cluster analysis is that it allows the simultaneous comparison ofintraspecific patterns. All the methods applied in the construction ofdendograms, from the calculation of genetic distance to the designing ofthe trees, are part of the “TREECON for Windows” software package .RESULTSThe cDNA and DNA extracted from all the strains were used as atemplate with five primers chosen at random. The products of the RAP-PCR and the RAPD generated polymorphic patterns (Fig. 1). Thepolymorphism of bands and its philogenetical meaning are representedas numbers in the matrixes (Fig. 2) that lists the genetic distance betweenthe strains calculated from RAPD and RAP-PCR data. The dendograms(Fig. 3) show a graphical idea of the information presented by thematrixes. The analysis of the tree based on the products of RAP-PCRdid not present a correlation with the virulence of the strains (Fig. 3B).The analysis of the dendogram based on RAPD (Fig. 3A) revealed twogroups, one formed by the strains isolated from symptomatic individualsand the other consisting of asymptomatic ones. The followingramifications corresponded to a greater or lesser virulence of the strainsbased on biological studies (Table 1).Table 1E. histolytica strains used in this studystrains clinical culture Virulence** zymodeme‡form* conditionsHM1 Sympt. Axenic Amoebic abscess PathogenicDegree IVCSP Sympt. Axenic Amoebic abscess Pathogenic Degree IVHK-9 Sympt. Axenic Amoebic abscess PathogenicDegree II200-NIH Sympt. Axenic Amoebic abscess PathogenicDegree II462 Asympt. Axenic Negative Pathogenic452 Asympt. Axenic Negative Pathogenic32 Asympt. Axenic Negative PathogenicRPS Asympt. Axenic Negative Pathogenic* Sympt. (symptomatic); Asympt. (asymptomatic).** The virulence was determined by inoculation into hamster liver4. The inocula size variation was 5 x 103 to 1 x 106 amoebae.‡ The zymodeme was determined as pathogenic or nonpathogenic according to the analysis of hexoquinase and phosphoglucomutase enzymes, as the parametersestablished by SARGEAUNT et al. (1978)15.VALLE, P.R.; SOUZA, M.B.G.; PIRES, E.M.; SILVA, E.F. & GOMES, M.A. - Arbitrarily primed PCR fingerprinting of RNA and DNA in Entamoeba histolytica. Rev. Inst. Med. trop. S.Paulo, 42(5): 249-253, 2000.Fig. 2 - Quadratic and symmetric matrixes of genetic distances calculated between strains of Entamoeba histolytica.Fig. 1 - 5% polyacrylamide silver stained gels showing fingerprints generated by analysis of RNA (RAP-PCR) and DNA (RAPD) of strains of E. histolytica using the primer L15. Lanes 1-8 asfollows: HM1, CSP, HK-9, 200-NIH, 462, 452, RPS and 32.VALLE, P.R.; SOUZA, M.B.G.; PIRES, E.M.; SILVA, E.F. & GOMES, M.A. - Arbitrarily primed PCR fingerprinting of RNA and DNA in Entamoeba histolytica. Rev. Inst. Med. trop. S.Paulo, 42(5): 249-253, 2000.DISCUSSIONThe protozoan parasite E. histolytica possesses an exceptionalcapacity for tissue destruction that can be considered as its principalpathogenic characteristic11. This capacity, however, is not found in allisolates. The identification and characterization of the molecular basesinvolved in its cytotoxicity have been sought, and several moleculeswere discovered as responsible for this function1,7,8,9,13. Different amebaemolecules, have been found in virulent strains, being present at lowerlevels or even absent in strains presenting low virulence2,3,5,12,17,19.Considerable diversity has also been found in the genes that code forsome of these proteins10. Nevertheless, there is no clear correlationbetween this protein diversity and the capacity to produce tissue damage.In view of the above we sought to evaluate the virulence of E.histolytica using the RAP-PCR technique as an approach to thedifferentiation of genes expression. We compared the results obtainedwith this method with the well-established RAPD technique. It wasbelieved that the results obtained using RAP-PCR with arbitrary primers,capable of evaluating RNA variability, would be more indicative of thevirulence of the strains, since this technique analyses the product ofgene transcription, determining the phenotype of the strains, and wouldthus presumably be more sensitive.The variability of RNA and DNA was analysed using dendogramsand a greater variability in the RNA was observed with the primersemployed here. However, this greater variability did not correlate withthe virulence of the strains. On the contrary, the DNA polymorphismvisualized by RAPD revealed a better concordance with strain virulence.These results suggest that, at least with the primers used, RAPD mayhave amplified neutral regions of the DNA of the samples that in theirphylogenetically conserved form did not suffer pressures of axenic cultureor prolonged manipulation in the laboratory. By contrast, RAP-PCRshould have amplified individual-specific regions, revealing the greatprotein variability within the species. These differentially amplifiedregions may constitute important molecules involved in the pathogenesisof amebiasis or could be the result of mutations due to prolongedmaintenance in the laboratory, and may thus constitute important potentialtargets for the understanding of the still-obscure aspects of the biologyof this parasite. Nevertheless, the RAP-PCR analysis did not differentiatebetween symptomatic and asymptomatic strains, as did the RAPD one.RESUMOImpressões digitais de DNA e RNA através de AP-PCR emEntamoeba histolyticaDiferenças na expressão gênica de cepas de E. histolytica foramobtidas pelo “fingerprinting” de RNA (RAP-PCR) e DNA (RAPD). Aanálise do perfil eletroforético do gel revelou alguns marcadorespolimórficos que poderiam ser usados na caracterização individual dascepas. As 260 bandas geradas pela utilização de cinco primers diferentes,tanto no RAP-PCR, quanto no RAPD foram empregadas na construçãode dendogramas. O dendograma obtido com os produtos do RAPDpermitiu a distinção das cepas isoladas de pacientes sintomáticos eassintomáticos, além de correlacionar o polimorfismo exibido com avirulência das mesmas. O dendograma obtido com os produtos do RAP-PCR não apresentou correlação com a virulência das cepas, mas revelouuma exuberante variabilidade transcricional intra-específica, que podeestar relacionada a outros caracteres biológicos envolvidos, ou não, napatogênese da amebíase.ACKNOWLEDGMENTSThis work was supported with grants from CNPq and FAPEMIG.REFERENCES1. ANDRÄ, J. & LEIPPE, M. - Pore-forming of Entamoeba histolytica. Significance ofpositively charged aminoacids residues for its mode of action. FEBS Lett., 354: 97-102, 1994.2. GOMES, M.A.; MELO, M.N.; PESQUERO, J.L. & SILVA, E.F. - Characterization forvirulence of an axenic strain of Entamoeba histolytica: evidence for overexpressionof two proteins. Arch. med. Res., 28: 489-492, 1997.Fig. 3 - Phylogenetic tree of E. histolytica strains derived from RAPD (A) and RAP-PCR (B) data. The genetic distance was calculated by LINK et al (1995)6 method and the tree constructedby clustering complete linkage method19.VALLE, P.R.; SOUZA, M.B.G.; PIRES, E.M.; SILVA, E.F. & GOMES, M.A. - Arbitrarily primed PCR fingerprinting of RNA and DNA in Entamoeba histolytica. Rev. Inst. Med. trop. S.Paulo, 42(5): 249-253, 2000.43. GONZALES-RUIZ, A.; HAQUE, R.; REHMAN, T. et al. - A monoclonal antibody fordistinction of invasive and non invasive clinical isolates of Entamoeba histolytica. J.clin. Microbiol., 30: 2807-2813, 1992.4. JARUMILINTA, R. & MAEGRAITH, B. - Enzymes of Entamoeba histolytica. Bull.Wld. Hlth. Org., 41: 269-273, 1961.5. LEIPPE, M. - Amoebapores. Parasit. today, 13: 178-183, 1997.6. LINK, W.; DIXKENS, C.; SINGH, M.; SCHWALL, M. & MELCHINGER, A.E. - Geneticdiversity  in  European  and  Mediterranean  faba  bean  germ plasm revealed byRAPD markers. Theoret. appl. Genet., 90: 27-32, 1995.7. LÓPEZ-REVILLA, R.; JIMÉNEZ-DELGADILLO, B.; CANTO-ORTIZ, L. & CHÁVEZ-DUEÑAS, L. - Variation of proteins and proteinases in Entamoeba histolytica lysatescontaining a protease inhibitor. Arch. med. Res., 23: 87-89, 1992.8. LUSHBAUGH, W.B.; HOFBAUER, A.F.; KAIRALLA, A.A.; CANTEY, J.R. &PITTMAN, F.E. - Relationship of cytotoxin of axenically cultivated Entamoebahistolytica to virulence. Gastroenterology, 86: 1488-1495, 1984.9. MIRELMAN, D.; KEREN, Z. & BRACHA, R. - Cloning and partial characterization ofan antigen detected on membrane surfaces of non-pathogenic strains of Entamoebahistolytica. Arch. med. Res., 23: 49-53, 1992.10. QUE, X. & REED, S.L. - The role of extracellular cysteine proteinase in pathogenesis ofEntamoeba histolytica invasion. Parasit. today, 13: 190-194, 1997.11. RAVDIN, J.L. - Amebiasis. Clin. infect. Dis., 20: 1453-1466, 1995.12. REED, S.L.; BOUVIER, J.; HIRATA, K. et al. - A unique cysteine proteinase gene ofpathogenic Entamoeba histolytica correlates with virulence. Arch. med. Res., 23:181-182, 1992.13. RIGOTHIER, M.C.; GARCÍA-RIVERA, G.; GUADERRAMA, M. & OROZCO, E. -Purification and functional characterization of the 112 kDa adhesin of Entamoebahistolytica. Arch. med. Res., 23: 239-241, 1992.14. SAMBROOK, J.; FRITSCH, E.F. & MANIATIS, T. - Molecular cloning. A laboratorymanual. 2 ed. New York, Cold Spring Harbor Laboratory Press, 1989.15. SARGEAUNT, P.G.; WILLIAMS, J.E. & GRENE, J.D. - The differentiation invasiveand non-invasive Entamoeba histolytica by isoenzyme Trans. roy. Soc. trop. Med.Hyg., 72: 519-521, 1978.16. STEINDEL, M.; DIAS NETO, E.; MENEZES, C.L.P.; ROMANHA, A.J. & SIMPSON,A.J.G. - Random amplified polymorphic DNA analysis of Trypanosoma cruzi strains.Molec. biochem. Parasit., 60: 71-79, 1993.17. TORIAN, B.E.; REED, S.L.; FLORES, B.M. et al. - The 96-kilodalton-antigen as anintegral membrane protein in pathogenic Entamoeba histolytica: potential differencesin pathogenic and nonpathogenic isolates. Infect. Immun., 58: 753-760, 1990.18. VAN DE PEER, Y. & DE WACHTER, R. - TREECON for Windows: a software packagefor the construction and drawing of evolutionary trees for the Microsoft Windowsenvironment. Comput. appl. Biosci., 10: 569-570, 1994.19. VARGAS, M.A. & OROZCO, E. - Entamoeba histolytica: changes in the zymodeme ofcloned nonpathogenic trophozoites cultured under different conditions. Parasit. Res.,79: 353-356, 1993.20. WELSH, J. & McCLELLAND, M. - Fingerprinting genomes using PCR with arbitraryprimers. Nucleic Acids Res., 18: 7213-7218, 1990.21. WELSH, J.; CHADA, K.; DALAL, S.S. et al. - Arbitrarily primed PCR fingerprinting ofRNA. Nucleic Acids Res., 20: 4965-4970, 1992.Received: 13 March 2000Accepted: 29 June 2000

Arbitrarily primed PCR fingerprinting of RNA and DNA in Entamoeba histolytica

https://www.revistas.usp.br/rimtsp/article/download/30451/32335

Impressões digitais de DNA e RNA através de AP-PCR em Entamoeba histolytica

Abstract

Similar works

Full text

Available Versions

Cadernos Espinosanos (E-Journal)