Anonymous nuclear markers were developed for Seychelles caecilian amphibians. Using a previously published bioinformatics pipeline (developed for Roche 454 data), 36 candidate anonymous nuclear loci (ANL) of at least 180 bp length were identified from Illumina MiSeq next generation sequencing data for five Seychelles species. We designed primer pairs for the 36 candidate ANL and tested these by PCR and Sanger sequencing. Seven ANL amplified and sequenced well for at least five of the six nominal Seychelles caecilian species (in three genera), and represent potentially useful markers for systematics and conservation. © 2014 Springer Science+Business Media Dordrecht

Day, JJ

Foster, PG

Gower, DJ

Lewis, CJ

Maddock, ST

Morel, C

Nussbaum, RA

Wilkinson, M

UCL Discovery

TECHNICAL NOTEDevelopment of anonymous nuclear markers from Illuminapaired-end data for Seychelles caecilian amphibians(Gymnophiona: Indotyphlidae)Claire J. Lewis • Simon T. Maddock • Julia J. Day • Ronald A. Nussbaum •Charles Morel • Mark Wilkinson • Peter G. Foster • David J. GowerReceived: 3 December 2013 / Accepted: 25 December 2013 / Published online: 11 January 2014 Springer Science+Business Media Dordrecht 2014Abstract Anonymous nuclear markers were developedfor Seychelles caecilian amphibians. Using a previouslypublished bioinformatics pipeline (developed for Roche454 data), 36 candidate anonymous nuclear loci (ANL) ofat least 180 bp length were identified from Illumina MiSeqnext generation sequencing data for five Seychelles spe-cies. We designed primer pairs for the 36 candidate ANLand tested these by PCR and Sanger sequencing. SevenANL amplified and sequenced well for at least five of thesix nominal Seychelles caecilian species (in three genera),and represent potentially useful markers for systematicsand conservation.Keywords Anonymous nuclear loci  Conservation Next generation sequencing  Population genetics SystematicsAnonymous nuclear loci (ANL) are markers in non-codingregions of the nuclear genome that are unlikely to be underselection and which have many potential applications inmolecular systematics, especially at lower taxonomic lev-els (Karl and Avise 1993). Traditionally, ANL discoveryinvolved time-consuming lab-work to generate a smallnumber of usable markers, but recently Bertozzi et al.(2012) described a bioinformatics pipeline to developcandidate ANL from next generation sequencing (NGS)data.Caecilians (Gymnophiona) are limbless, mostly soil-dwelling amphibians largely restricted to the moist tropics,and the approximately 200 extant species comprise one ofthe most poorly known major vertebrate groups (Gowerand Wilkinson 2008; Wilkinson 2012). Anonymousnuclear markers have not previously been developed forcaecilians, microsatellites have been developed for onlytwo species (Li et al. 2010; Barratt et al. 2012), and pub-lished coding nuclear data are not very variable at lowertaxonomic levels.A radiation of six nominal caecilian species in threegenera (Grandisonia, Hypogeophis, Praslinia) occurs inthe Seychelles (Nussbaum 1984; Wilkinson and Nussbaum2006; Wilkinson et al. 2011). Although clearly monophy-letic (Nussbaum and Ducey 1988; Hedges et al. 1993;Gower et al. 2011), analyses of (mostly mtDNA) sequencedata have been unable to robustly resolve all relationshipsamong the radiation (Hedges et al. 1993; Wilkinson et al.2002, 2003; Loader et al. 2007; Gower et al. 2008, 2011).ANL could provide a useful tool for Seychelles caeciliansystematics and conservation genetics, especially given theincreased levels of threat faced, in general, by island biotas(e.g., Frankham 2008). Two Seychelles caecilians (P.cooperi and H. brevis) are classified as Endangered on theIUCN Red List.Electronic supplementary material The online version of thisarticle (doi:10.1007/s12686-013-0127-y) contains supplementarymaterial, which is available to authorized users.C. J. Lewis  S. T. Maddock (&)  M. Wilkinson P. G. Foster  D. J. GowerDepartment of Life Sciences, The Natural History Museum,London SW7 5BD, UKe-mail: s.t.maddock@gmail.comC. J. Lewis  S. T. Maddock  J. J. Day  M. WilkinsonDepartment of Genetics, Evolution and Environment,University College London, London WC1E 6BT, UKR. A. NussbaumMuseum of Zoology, University of Michigan, Ann Arbor,MI 48109, USAC. MorelNatural History Museum, Victoria, Mahe´, Seychelles123Conservation Genet Resour (2014) 6:289–291DOI 10.1007/s12686-013-0127-ySix samples from five Seychelles caecilian species (allSeychelles species except P. cooperi; two samples of G.alternans) were selected for marker development usingNGS. Genomic DNA was extracted from liver using Qia-gen DNeasy Blood and Tissue kits. Samples were preparedusing a standard Illumina Nextera DNA kit and paired-endreads (B251 bp long) sequenced using a 500 cycle v.2reagent kit on the Illumina MiSeq platform. Paired-enddata were combined and cleaned using default settings inGeneious v.6.1.4. Cleaned files were run through Bertozziet al.’s (2012) Perl bioinformatics pipeline, with our cus-tomised BLAST database comprising the Xenopus tropi-calis and Danio rerio genomes plus all caecilian entries inGenBank. Each sample was run through the pipelineindividually (see supplementary material). Candidateanonymous nuclear markers were selected at random frompaired reads C245 bp, and 36 primer pairs (6 per sample)were designed using Primer3 v.0.4.0 (Koressaar and Remm2007; Untergrasser et al. 2012). Primer sequences wereselected on the basis of being closest to the beginning ofthe 50–30 end of each read (to maximise length), and havinglow self-complementarity and annealing temperatures of60 C (±1 C); all other settings were default. Primersequences were subjected to an additional BLAST searchto check locus anonymity.The 36 primer pairs were tested using the polymerasechain reaction (PCR) for five genomic DNA samples, onefor each of the non-P. cooperi Seychelles species (seesupplementary material). Reaction volume was 25 ll: 1 lltemplate, 1 ll for each primer, 9.5 ll of dd H2O, 12.5 ll ofMyTaq Mix 92. Cycling conditions for all primer pairswere: 95 C-3 min; 359 [95 C-15 s, 60 C-15 s,72 C-20 s]; 72 C-10 min. Fifteen of the 36 primer pairssuccessfully amplified DNA in all five species, and ampli-cons for these were subjected to Sanger sequencing.Assembled and edited sequences were aligned using defaultsettings for consensus alignments in Geneious. Eight of the15 loci were considered suitable for further testing; the sevenloci rejected at this stage generally yielded poor sequences,perhaps indicative of suboptimal primer/template combina-tions and/or PCR settings. Sequences were subjected to aBLAST search to check anonymity.The eight surviving candidate ANL were tested furtherby attempting PCR amplification of genomic DNA from 12additional individuals of the five species for which they hadalready worked plus two individuals of their Seychellessister species P. cooperi (see supplementary material).Descriptive statistics were generated using DnaSP v.5.10(Librado and Rozas 2009) for seven ANL (see Table 1); allwere variable across the Seychelles species. One locus wasexcluded from DnaSP analysis because it failed tosequence well in any specimen of H. rostratus or G.larvata.Our NGS data initially produced approximately 5,000candidate ANL with a potential length of C245 bp.Approximately 20 % of the 36 candidate ANL that wesubsequently randomly selected were found to generallyamplify and sequence well and showed variability in theTable 1 The seven anonymous nuclear markers developed successfully in this studyLocus Primer sequences50–30Length (range) SA (SS) Spp. PS Indels (range) VS %Alt15 F: GCCTTGCATCCCCTAATACAR: GCACACACTGTCGGCTTAAA283 (137–283) 17 (11) 6 24 6 (1–24) 8.5Alt23 F: TCCATAGGAAGGGAGCAAGAR: CTGCCCGCTTTCTTTGTAAC299 (277–298) 16 (10) 5 24 4 (1–14) 8.4Brev2 F: TAGAAGCCGAGGGTTATTGGR: GAAGAGAAGGTGGGACAGGA199 (187–199) 19 (9) 5 21 1 (8) 11.1Brev5 F: CATCAGGTCATTGGCGTTTAR: GAGTGCAGGGACCAAATACC324 (273–323) 17 (10) 6 35 3 (1) 11.1Rost1 F: TCTGGAATTGGCCTTGTGTTR: CCCACATTCTTCCTCCCTCT291 (288–291) 15 (7) 5 22 3 (1–2) 8.6Rost5 F: TGTCAACTGCCCTCTGTGTCR: AAATTCACAGGCCAAACAGG326 (319–325) 14 (11) 6 24 5 (1–2) 8.3Sech5 F: GCAGCTCTTTCTGTGCCTTTR: GTCTGCCATTGCTGTATGGA180 16 (10) 6 25 0 13.9For each locus we report (columns, from left to right) locus name; primers; length in base pairs of aligned sequences; the number of genomicDNA samples out of 19 for which PCR amplification worked (SA) and for which sequence data were successfully obtained (SS); the number ofspecies out of six for which amplificiations were achieved and for which amplicons were sequenced successfully (Spp.); the number ofpolymorphic sites (PS); the number of indels across the alignment (and per sequence, in parentheses); the percentage of variable sites excludingindels (VS %). See online resources for additional details290 Conservation Genet Resour (2014) 6:289–291123Seychelles caecilians. Our successful approach differedfrom Bertozzi et al.’s (2012) in that we developed ANLfrom Illumina NGS data rather than from the moreexpensive Roche 454 platform, albeit at the expense ofsequence length.Acknowledgments For help with office, lab and fieldwork we thankRachel Bristol, Pat Dyal, Jim Labisko, Greg Schneider, BrunoSimo˜es, Martijn Timmermans and Gill Sparrow. The SeychellesBureau of Standards provided field collection and export permits.STM thanks the Seychelles National Park Authority for supporting hisapplication for a gainful occupancy permit. Funded in part by anNHM/UCL PhD studentship and Systematics Association ResearchFund Grant (to STM), and a SynTax grant and Darwin Initiative grant19-002 (to MW, JJD and DJG).ReferencesBarratt CD, Horsburgh GJ, Dawson DA, Gower DJ, Wilkinson M,Loader SP, Jehle R (2012) Characterisation of nine microsatelliteloci in the caecilian amphibian Boulengerula uluguruensis(Gymnophiona), and their cross-species utility in three conge-neric species. Conserv Genet Resour 4:225–229Bertozzi T, Sanders KL, Sistrom MJ, Gardner MG (2012) Anony-mous nuclear loci in non-model organisms: making the most ofhigh throughput genome surveys. Bioinformatics 28:1807–1810Frankham R (2008) Inbreeding and extinction: island populations.Conserv Biol 12:665–675Gower DJ, Wilkinson M (2008) Caecilians (Gymnophiona). In: StuartSN, Hoffman M, Chanson JS, Cox NA, Berridge R, Ramani P,Young BE (eds) Threatened amphibians of the world. LynxEdicones with IUCN—The World Conservation Union. Conser-vation International and NatureServe, Barcelona, pp 19–20Gower DJ, Giri V, Dharne MS, Shouche Y (2008) Frequency ofindependent origins of viviparity among caecilians (Gymnophi-ona): evidence from the first ‘live-bearing’ Asian amphibian.J Evol Biol 2:1220–1226Gower DJ, San Mauro D, Giri V, Bhatta G, Venu G, RamachandranK, Oommen OV, Fatih FA, Mackenzie-Dodds JA, NussbaumRA, Biju SD, Shouche TS, Wilkinson M (2011) Molecularsystematics of caeciliid caecilians (Amphibia: Gymnophiona) ofthe Western Ghats, India. Mol Phylogenet Evol 59:698–707Hedges SB, Nussbaum RA, Maxson LR (1993) Caecilian phylogenyand biogeography inferred from mitochondrial DNA sequencesof the 12S rRNA and 16S rRNA genes (Amphibia: Gymnophi-ona). Herpetol Monogr 7:64–76Karl SA, Avise JC (1993) PCR-based assays of mendelian polymor-phisms from anonymous single-copy nuclear DNA: techniquesand applications for population genetics. Mol Biol Evol10:342–361Koressaar T, Remm M (2007) Enhancements and modifications ofprimer design program Primer3. Bioinformatics 23:1289–1291Li G, Luo X, Wang H, Bei Y, Shi W, Meng S, Zhang B (2010)Isolation and characterization of fifteen polymorphic tetranucle-otide microsatellites for Ichthyophis bannanicus (Gymnophiona:Ichthyophiidae). Conserv Genet Resour 2:129–131Librado P, Rozas J (2009) DnaSP v5: a software for comprehensiveanalysis of DNA polymorphism data. Bioinformatics25:1451–1452Loader SP, Pisani D, Cotton JA, Gower DJ, Day JJ, Wilkinson M(2007) Relative time scales reveal multiple origins of paralleldisjunct distributions of African caecilian amphibians. Biol Lett3:505–508Nussbaum RA (1984) Amphibians of the Seychelles. In: Stoddart DR(ed) Biogeography and ecology of the Seychelles islands. Dr.W. Junk, The Hague, pp 379–415Nussbaum RA, Ducey PK (1988) Cytological evidence for mono-phyly of the caecilians (Amphibia: Gymnophiona) of theSeychelles archipelago. Herpetologica 44:290–296Untergrasser A, Cutcutache I, Koressaar T, Ye J, Faircloth BC, RemmM, Rozen SG (2012) Primer3—new capabilities and interfaces.Nucleic Acids Res 40:e115Wilkinson M (2012) Caecilians. Curr Biol 22:R668–R669Wilkinson M, Nussbaum RA (2006) Caecilian phylogeny andclassification. In: Exbrayat J-M (ed) Reproductive biology andphylogeny of Gymnophiona (caecilians). Science PublishersInc., Enfield, New Hampshire, pp 39–78Wilkinson M, Sheps JA, Oommen OV, Cohen BL (2002) Phyloge-netic relationships of Indian caecilians (Amphibia: Gymnophi-ona) inferred from mitochondrial rRNA gene sequences. MolPhylogenet Evol 23:401–407Wilkinson M, Loader SP, Gower DJ, Sheps JA, Cohen BL (2003)Phylogenetic relationships of African caecilians (Amphibia:Gymnophiona): insights from mitochondrial rRNA genesequences. Afr J Herpetol 52:83–92Wilkinson M, San Mauro D, Sherratt E, Gower DJ (2011) A nine-family classification of caecilians (Amphibia: Gymnophiona).Zootaxa 2874:41–64Conservation Genet Resour (2014) 6:289–291 291123

Development of anonymous nuclear markers from Illumina paired-end data for Seychelles caecilian amphibians (Gymnophiona: Indotyphlidae)

Claire J. Lewis

Simon T. Maddock

Julia J. Day

Ronald A. Nussbaum

Charles Morel

Mark Wilkinson

Peter G. Foster

David J. Gower

Springer - Publisher Connector

TECHNICAL NOTE
Development of anonymous nuclear markers from Illumina
paired-end data for Seychelles caecilian amphibians
(Gymnophiona: Indotyphlidae)
Claire J. Lewis • Simon T. Maddock • Julia J. Day • Ronald A. Nussbaum •
Charles Morel • Mark Wilkinson • Peter G. Foster • David J. Gower
Received: 3 December 2013 / Accepted: 25 December 2013 / Published online: 11 January 2014
 Springer Science+Business Media Dordrecht 2014
Abstract Anonymous nuclear markers were developed
for Seychelles caecilian amphibians. Using a previously
published bioinformatics pipeline (developed for Roche
454 data), 36 candidate anonymous nuclear loci (ANL) of
at least 180 bp length were identified from Illumina MiSeq
next generation sequencing data for five Seychelles spe-
cies. We designed primer pairs for the 36 candidate ANL
and tested these by PCR and Sanger sequencing. Seven
ANL amplified and sequenced well for at least five of the
six nominal Seychelles caecilian species (in three genera),
and represent potentially useful markers for systematics
and conservation.
Keywords Anonymous nuclear loci  Conservation 
Next generation sequencing  Population genetics 
Systematics
Anonymous nuclear loci (ANL) are markers in non-coding
regions of the nuclear genome that are unlikely to be under
selection and which have many potential applications in
molecular systematics, especially at lower taxonomic lev-
els (Karl and Avise 1993). Traditionally, ANL discovery
involved time-consuming lab-work to generate a small
number of usable markers, but recently Bertozzi et al.
(2012) described a bioinformatics pipeline to develop
candidate ANL from next generation sequencing (NGS)
data.
Caecilians (Gymnophiona) are limbless, mostly soil-
dwelling amphibians largely restricted to the moist tropics,
and the approximately 200 extant species comprise one of
the most poorly known major vertebrate groups (Gower
and Wilkinson 2008; Wilkinson 2012). Anonymous
nuclear markers have not previously been developed for
caecilians, microsatellites have been developed for only
two species (Li et al. 2010; Barratt et al. 2012), and pub-
lished coding nuclear data are not very variable at lower
taxonomic levels.
A radiation of six nominal caecilian species in three
genera (Grandisonia, Hypogeophis, Praslinia) occurs in
the Seychelles (Nussbaum 1984; Wilkinson and Nussbaum
2006; Wilkinson et al. 2011). Although clearly monophy-
letic (Nussbaum and Ducey 1988; Hedges et al. 1993;
Gower et al. 2011), analyses of (mostly mtDNA) sequence
data have been unable to robustly resolve all relationships
among the radiation (Hedges et al. 1993; Wilkinson et al.
2002, 2003; Loader et al. 2007; Gower et al. 2008, 2011).
ANL could provide a useful tool for Seychelles caecilian
systematics and conservation genetics, especially given the
increased levels of threat faced, in general, by island biotas
(e.g., Frankham 2008). Two Seychelles caecilians (P.
cooperi and H. brevis) are classified as Endangered on the
IUCN Red List.
Electronic supplementary material The online version of this
article (doi:10.1007/s12686-013-0127-y) contains supplementary
material, which is available to authorized users.
C. J. Lewis  S. T. Maddock (&)  M. Wilkinson 
P. G. Foster  D. J. Gower
Department of Life Sciences, The Natural History Museum,
London SW7 5BD, UK
e-mail: s.t.maddock@gmail.com
C. J. Lewis  S. T. Maddock  J. J. Day  M. Wilkinson
Department of Genetics, Evolution and Environment,
University College London, London WC1E 6BT, UK
R. A. Nussbaum
Museum of Zoology, University of Michigan, Ann Arbor,
MI 48109, USA
C. Morel
Natural History Museum, Victoria, Mahe´, Seychelles
123
Conservation Genet Resour (2014) 6:289–291
DOI 10.1007/s12686-013-0127-y
Six samples from five Seychelles caecilian species (all
Seychelles species except P. cooperi; two samples of G.
alternans) were selected for marker development using
NGS. Genomic DNA was extracted from liver using Qia-
gen DNeasy Blood and Tissue kits. Samples were prepared
using a standard Illumina Nextera DNA kit and paired-end
reads (B251 bp long) sequenced using a 500 cycle v.2
reagent kit on the Illumina MiSeq platform. Paired-end
data were combined and cleaned using default settings in
Geneious v.6.1.4. Cleaned files were run through Bertozzi
et al.’s (2012) Perl bioinformatics pipeline, with our cus-
tomised BLAST database comprising the Xenopus tropi-
calis and Danio rerio genomes plus all caecilian entries in
GenBank. Each sample was run through the pipeline
individually (see supplementary material). Candidate
anonymous nuclear markers were selected at random from
paired reads C245 bp, and 36 primer pairs (6 per sample)
were designed using Primer3 v.0.4.0 (Koressaar and Remm
2007; Untergrasser et al. 2012). Primer sequences were
selected on the basis of being closest to the beginning of
the 50–30 end of each read (to maximise length), and having
low self-complementarity and annealing temperatures of
60 C (±1 C); all other settings were default. Primer
sequences were subjected to an additional BLAST search
to check locus anonymity.
The 36 primer pairs were tested using the polymerase
chain reaction (PCR) for five genomic DNA samples, one
for each of the non-P. cooperi Seychelles species (see
supplementary material). Reaction volume was 25 ll: 1 ll
template, 1 ll for each primer, 9.5 ll of dd H2O, 12.5 ll of
MyTaq Mix 92. Cycling conditions for all primer pairs
were: 95 C-3 min; 359 [95 C-15 s, 60 C-15 s,
72 C-20 s]; 72 C-10 min. Fifteen of the 36 primer pairs
successfully amplified DNA in all five species, and ampli-
cons for these were subjected to Sanger sequencing.
Assembled and edited sequences were aligned using default
settings for consensus alignments in Geneious. Eight of the
15 loci were considered suitable for further testing; the seven
loci rejected at this stage generally yielded poor sequences,
perhaps indicative of suboptimal primer/template combina-
tions and/or PCR settings. Sequences were subjected to a
BLAST search to check anonymity.
The eight surviving candidate ANL were tested further
by attempting PCR amplification of genomic DNA from 12
additional individuals of the five species for which they had
already worked plus two individuals of their Seychelles
sister species P. cooperi (see supplementary material).
Descriptive statistics were generated using DnaSP v.5.10
(Librado and Rozas 2009) for seven ANL (see Table 1); all
were variable across the Seychelles species. One locus was
excluded from DnaSP analysis because it failed to
sequence well in any specimen of H. rostratus or G.
larvata.
Our NGS data initially produced approximately 5,000
candidate ANL with a potential length of C245 bp.
Approximately 20 % of the 36 candidate ANL that we
subsequently randomly selected were found to generally
amplify and sequence well and showed variability in the
Table 1 The seven anonymous nuclear markers developed successfully in this study
Locus Primer sequences
50–30
Length (range) SA (SS) Spp. PS Indels (range) VS %
Alt15 F: GCCTTGCATCCCCTAATACA
R: GCACACACTGTCGGCTTAAA
283 (137–283) 17 (11) 6 24 6 (1–24) 8.5
Alt23 F: TCCATAGGAAGGGAGCAAGA
R: CTGCCCGCTTTCTTTGTAAC
299 (277–298) 16 (10) 5 24 4 (1–14) 8.4
Brev2 F: TAGAAGCCGAGGGTTATTGG
R: GAAGAGAAGGTGGGACAGGA
199 (187–199) 19 (9) 5 21 1 (8) 11.1
Brev5 F: CATCAGGTCATTGGCGTTTA
R: GAGTGCAGGGACCAAATACC
324 (273–323) 17 (10) 6 35 3 (1) 11.1
Rost1 F: TCTGGAATTGGCCTTGTGTT
R: CCCACATTCTTCCTCCCTCT
291 (288–291) 15 (7) 5 22 3 (1–2) 8.6
Rost5 F: TGTCAACTGCCCTCTGTGTC
R: AAATTCACAGGCCAAACAGG
326 (319–325) 14 (11) 6 24 5 (1–2) 8.3
Sech5 F: GCAGCTCTTTCTGTGCCTTT
R: GTCTGCCATTGCTGTATGGA
180 16 (10) 6 25 0 13.9
For each locus we report (columns, from left to right) locus name; primers; length in base pairs of aligned sequences; the number of genomic
DNA samples out of 19 for which PCR amplification worked (SA) and for which sequence data were successfully obtained (SS); the number of
species out of six for which amplificiations were achieved and for which amplicons were sequenced successfully (Spp.); the number of
polymorphic sites (PS); the number of indels across the alignment (and per sequence, in parentheses); the percentage of variable sites excluding
indels (VS %). See online resources for additional details
290 Conservation Genet Resour (2014) 6:289–291
123
Seychelles caecilians. Our successful approach differed
from Bertozzi et al.’s (2012) in that we developed ANL
from Illumina NGS data rather than from the more
expensive Roche 454 platform, albeit at the expense of
sequence length.
Acknowledgments For help with office, lab and fieldwork we thank
Rachel Bristol, Pat Dyal, Jim Labisko, Greg Schneider, Bruno
Simo˜es, Martijn Timmermans and Gill Sparrow. The Seychelles
Bureau of Standards provided field collection and export permits.
STM thanks the Seychelles National Park Authority for supporting his
application for a gainful occupancy permit. Funded in part by an
NHM/UCL PhD studentship and Systematics Association Research
Fund Grant (to STM), and a SynTax grant and Darwin Initiative grant
19-002 (to MW, JJD and DJG).
References
Barratt CD, Horsburgh GJ, Dawson DA, Gower DJ, Wilkinson M,
Loader SP, Jehle R (2012) Characterisation of nine microsatellite
loci in the caecilian amphibian Boulengerula uluguruensis
(Gymnophiona), and their cross-species utility in three conge-
neric species. Conserv Genet Resour 4:225–229
Bertozzi T, Sanders KL, Sistrom MJ, Gardner MG (2012) Anony-
mous nuclear loci in non-model organisms: making the most of
high throughput genome surveys. Bioinformatics 28:1807–1810
Frankham R (2008) Inbreeding and extinction: island populations.
Conserv Biol 12:665–675
Gower DJ, Wilkinson M (2008) Caecilians (Gymnophiona). In: Stuart
SN, Hoffman M, Chanson JS, Cox NA, Berridge R, Ramani P,
Young BE (eds) Threatened amphibians of the world. Lynx
Edicones with IUCN—The World Conservation Union. Conser-
vation International and NatureServe, Barcelona, pp 19–20
Gower DJ, Giri V, Dharne MS, Shouche Y (2008) Frequency of
independent origins of viviparity among caecilians (Gymnophi-
ona): evidence from the first ‘live-bearing’ Asian amphibian.
J Evol Biol 2:1220–1226
Gower DJ, San Mauro D, Giri V, Bhatta G, Venu G, Ramachandran
K, Oommen OV, Fatih FA, Mackenzie-Dodds JA, Nussbaum
RA, Biju SD, Shouche TS, Wilkinson M (2011) Molecular
systematics of caeciliid caecilians (Amphibia: Gymnophiona) of
the Western Ghats, India. Mol Phylogenet Evol 59:698–707
Hedges SB, Nussbaum RA, Maxson LR (1993) Caecilian phylogeny
and biogeography inferred from mitochondrial DNA sequences
of the 12S rRNA and 16S rRNA genes (Amphibia: Gymnophi-
ona). Herpetol Monogr 7:64–76
Karl SA, Avise JC (1993) PCR-based assays of mendelian polymor-
phisms from anonymous single-copy nuclear DNA: techniques
and applications for population genetics. Mol Biol Evol
10:342–361
Koressaar T, Remm M (2007) Enhancements and modifications of
primer design program Primer3. Bioinformatics 23:1289–1291
Li G, Luo X, Wang H, Bei Y, Shi W, Meng S, Zhang B (2010)
Isolation and characterization of fifteen polymorphic tetranucle-
otide microsatellites for Ichthyophis bannanicus (Gymnophiona:
Ichthyophiidae). Conserv Genet Resour 2:129–131
Librado P, Rozas J (2009) DnaSP v5: a software for comprehensive
analysis of DNA polymorphism data. Bioinformatics
25:1451–1452
Loader SP, Pisani D, Cotton JA, Gower DJ, Day JJ, Wilkinson M
(2007) Relative time scales reveal multiple origins of parallel
disjunct distributions of African caecilian amphibians. Biol Lett
3:505–508
Nussbaum RA (1984) Amphibians of the Seychelles. In: Stoddart DR
(ed) Biogeography and ecology of the Seychelles islands. Dr.
W. Junk, The Hague, pp 379–415
Nussbaum RA, Ducey PK (1988) Cytological evidence for mono-
phyly of the caecilians (Amphibia: Gymnophiona) of the
Seychelles archipelago. Herpetologica 44:290–296
Untergrasser A, Cutcutache I, Koressaar T, Ye J, Faircloth BC, Remm
M, Rozen SG (2012) Primer3—new capabilities and interfaces.
Nucleic Acids Res 40:e115
Wilkinson M (2012) Caecilians. Curr Biol 22:R668–R669
Wilkinson M, Nussbaum RA (2006) Caecilian phylogeny and
classification. In: Exbrayat J-M (ed) Reproductive biology and
phylogeny of Gymnophiona (caecilians). Science Publishers
Inc., Enfield, New Hampshire, pp 39–78
Wilkinson M, Sheps JA, Oommen OV, Cohen BL (2002) Phyloge-
netic relationships of Indian caecilians (Amphibia: Gymnophi-
ona) inferred from mitochondrial rRNA gene sequences. Mol
Phylogenet Evol 23:401–407
Wilkinson M, Loader SP, Gower DJ, Sheps JA, Cohen BL (2003)
Phylogenetic relationships of African caecilians (Amphibia:
Gymnophiona): insights from mitochondrial rRNA gene
sequences. Afr J Herpetol 52:83–92
Wilkinson M, San Mauro D, Sherratt E, Gower DJ (2011) A nine-
family classification of caecilians (Amphibia: Gymnophiona).
Zootaxa 2874:41–64
Conservation Genet Resour (2014) 6:289–291 291
123


file:///data/core-remote/dit/data/Springer-OA/pdf/f3e/aHR0cDovL2xpbmsuc3ByaW5nZXIuY29tLzEwLjEwMDcvczEyNjg2LTAxMy0wMTI3LXkucGRm.pdf

Development of anonymous nuclear markers from Illumina paired-end data for Seychelles caecilian amphibians (Gymnophiona: Indotyphlidae)

Abstract

Similar works

Full text

Available Versions

UCL Discovery

Springer - Publisher Connector