Respiratory syncytial virus group A strain variations of 28 isolates from
      The Netherlands collected during three consecutive seasons were studied by
      ana

Beek, R. (Ruud) van

Brandenburg, A.H. (Afke)

Claas, E.C.J. (Eric)

Moll, H.A. (Henriëtte)

Osterhaus, A.D.M.E. (Albert)

Brandenburg, AH (Afke)

Beek, Ruud

Moll, Henriette

Osterhaus, Ab

Claas, ECJ

EUR Research Repository

JOURNAL OF CLINICAL MICROBIOLOGY,0095-1137/00/$04.0010Oct. 2000, p. 3849–3852 Vol. 38, No. 10Copyright © 2000, American Society for Microbiology. All Rights Reserved.G Protein Variation in Respiratory Syncytial Virus Group ADoes Not Correlate with Clinical SeverityA. H. BRANDENBURG,1† R. VAN BEEK,1 H. A. MOLL,2 A. D. M. E. OSTERHAUS,1* AND E. C. J. CLAAS1‡Institute of Virology, Erasmus University Hospital, 3000 DR Rotterdam,1 and the Department of Paediatrics, SophiaChildren’s Hospital, 3015 GE Rotterdam,2 The NetherlandsReceived 12 June 2000/Returned for modification 25 July 2000/Accepted 9 August 2000Respiratory syncytial virus group A strain variations of 28 isolates from The Netherlands collected duringthree consecutive seasons were studied by analyzing G protein sequences. Several lineages circulated repeat-edly and simultaneously during the respective seasons. No relationships were found between lineages on theone hand and clinical severity or age on the other.Respiratory syncytial virus (RSV) can be divided into twogroups, A and B, on the basis of the reaction with monoclonalantibodies directed against the F and G proteins (1, 23) andnucleotide sequence differences of several genes (5, 16, 30, 31).These two groups circulate independently in the human pop-ulation, with group A being the most prevalent (14, 23).Also, within the two groups substantial strain differenceshave been described, mainly associated with the divergence inthe gene encoding the G protein (17), which is the most vari-able protein of the virus. Several lineages within groups A andB also seem to cocirculate simultaneously in the population (3,30). Studies on RSV strains show an accumulation of aminoacid changes over the years, suggesting antigenic drift-based,immunity-mediated selection (4, 5, 8, 15, 27).One of the most interesting features of RSV is its ability tocause repeated infections throughout life (9, 11). This enablesRSV to remain present at high levels in the population, and ithas been estimated that at least 50% of children encountertheir first RSV infection during their first winter season. Strainvariation is thought to contribute to its ability to cause frequentreinfections (4, 8, 32).The clinical severity of RSV infection is associated withepidemiological and host factors, which include socioeconomicstatus (26), age (26), prematurity (25), and underlying heartand/or lung disease (10, 19). Several studies have evaluateddifferences in clinical severity between groups A and B. Inabout half of these studies, no differences in clinical severitywere detected between the groups involved (14, 18, 21, 22, 28,34, 37), and in the other studies, group A seemed to be asso-ciated with more severe clinical disease (12, 13, 20, 23, 29, 33,36). It has been suggested that virus variants within group Aare responsible for this discrepancy (7, 12, 36).To further address this issue, we selected group A strainsfrom three consecutive winter seasons and subjected isolates ofthese strains to sequence analyses of part of the G protein. Thestrains were isolated from children for whom standardizedclinical data were available from a previous study concerningRSV-A versus RSV-B and clinical severity (18).RSV isolates (n 5 293) found in routine diagnostics duringthree consecutive winter seasons were typed by performingdirect immune fluorescence on cells from nasopharyngealwashings using specific monoclonal antibodies MAB 92-11Cfor group A and MAB 109-10B for group B (Chemicon, Te-mecula, Calif.) as previously described (2). Twenty-eight RSVgroup A isolates were selected for sequence analysis.All five group A strains available from the first season(1992–1993) were included. Eleven from the second season(1993–1994) and twelve from the third season (1994–1995)were selected from children who had experienced either a mildinfection (not admitted) or a severe infection as determined byclinical parameters upon admission (see below).Demographic and clinical data on the children during theacute phase and at the time of the control visit were collectedin a previous study (18). Briefly, the data included gender, age,duration of pregnancy, underlying disease, feeding difficulties,history of apnea, the presence of retractions, respiratory rate,oxygen saturation (SaO2) in room air, partial CO2 pressure(pCO2), pH, abnormalities on X rays, admission to an inten-sive care unit, and the need for artificial ventilation. SevereRSV infection was defined as meeting one or more of thefollowing criteria: pCO2 . 6.6 kPa, SaO2 , 90%, and/or theneed for artificial ventilation.Viral RNA extraction and amplification of the viral RNA byreverse transcriptase PCR were carried out as described pre-viously (35). Briefly, RNA was extracted from 100 ml of culturesupernatant using a guanidinium isothiocyanate solution andwas collected by precipitation with isopropanol. The viral RNAwas then amplified by reverse transcriptase PCR using oligo-nucleotide primers G(A)-173s (GGCAATGATAATCTCAACTTC) and G(A)-525as (TGAATATGCTGCAGGGTACT),which resulted in an amplified fragment of 392 bp spanning thefirst hypervariable region of the G protein (amino acids [aa]100 to 132). The amplified products were subjected to nucle-otide sequence analysis by cycle sequencing using an ABI dyeterminator sequencing system and analysis on an ABI Prism377 DNA sequencer (PE Applied Biosystems, Nieuwerkerka/d IJssel, The Netherlands). Alignment of the nucleotide se-quences of the G protein gene of the RSV isolates was carriedout using the GCG package (Madison, Wis.). Multiple se-quence files were analyzed by DNAPARS in the PHYLIPpackage (6). Subsequently, phenograms were generated usingthe DRAWGRAM program.Clinical data of patients from the respective seasons werecompared in a x2 test, Fisher’s exact test, or Mann-Whitney Utest when applicable.During the three winter seasons, 232 children younger than* Corresponding author. Mailing address: Institute of Virology,Erasmus University Rotterdam, P.O. Box 1738, 3000 DR Rotterdam,The Netherlands. Phone: 31-10-4088066. Fax: 31-10-4089485. E-mail:osterhaus@viro.fgg.eur.nl.† Present address: LVF, 8917 EN Leeuwarden, The Netherlands.‡ Present address: Department of Virology, Leiden University Med-ical Center, 2300 RC Leiden, The Netherlands.384912 months of age were diagnosed with a RSV infection bydirect immune fluorescence and/or virus isolation. In 1992–1993 a predominance of group B viruses was found, season1993–1994 showed a mixed epidemic, and in season 1994–1995all children were infected with group A viruses (18). Figure 1shows the numbers of RSV isolates in The Netherlands perweek during the three seasons. In the 1994–1995 season, ashort steep peak in the first weeks of December was observed.During this third season, more children younger than 1 monthof age were admitted. Children in the third season had a highermean pCO2 and lower pH (Table 1) than children in the firsttwo seasons. No other differences in parameters known tocorrelate with clinical severity could be objectively measured.G protein amplicons of 28 RSV group A isolates dividedover the three seasons were studied by sequence analysis, anda phenogram was generated (Fig. 2). Season of infection, ageupon diagnosis, and clinical parameters—severity score, artifi-cial ventilation, and apnea—are indicated in the phenogram.Several lineages of RSV were found to be present during thethree seasons studied, and several lineages could be identifiedduring all three seasons. Closely related strains were alsofound to occur in subsequent seasons. The observed clusteringof the RSV isolates proved to be independent of season orpatient-related parameters (Fig. 2).Thus, several lineages of RSV-A cocirculated during thethree seasons studied, and clinically severe as well as mildercases were evenly distributed over the different lineages found.RSV infections are usually found during several months inthe winter season. In the 1994–1995 season, a relatively highincidence of RSV infections during a relatively short periodwas found. In the 1994–1995 season, more children from thevery young age group were admitted. The only clinical param-eters objectively found to be more severe in the 1994–1995season were the pCO2 and the pH. These parameters may bedirectly related to the younger age of the children involved,since a significant relationship between pCO2 and age has beenpreviously described (24).The RSV-G protein is the most variable of the RSV pro-teins; therefore, we chose to sequence a variable part of theRSV-G protein to study strain variation within subgroup A.However, it is not known where in the RSV genome putativevirulence factors would be located. Since we sequenced only asmall part of the genome, it cannot be fully excluded thatmutations important for virulence elsewhere on the RSV ge-nome were missed.The isolates from the 1994–1995 season were all of group A.We investigated whether this peak represented a single, pos-sibly more virulent, strain of RSV-A. Despite the limited num-ber of strains that were sequenced, it was clear that in the1994–1995 season, as well as in the other two seasons, severaldifferent strains cocirculated, and severe infections or youngerage proved not to be related to one particular strain. In addi-tion, closely related strains were found during different sea-sons, as has been described previously (3, 8, 30).FIG. 1. Number of RSV isolates per week during the three seasons studied, as recorded by the combined Dutch Virology Laboratories. (Published with permissionof the Dutch Working Group on Clinical Virology.)TABLE 1. Clinical parameters of RSV-infected patients duringthree consecutive seasonsPatient variableSeasonPa1992–1993 and1993–1994 1994–1995No. of children 130 102 NSNo. (%) ,37 mo gestation 37 (28.5) 21 (20.5) NSNo. (%) ,1 mo old 9 (6.9) 17 (16.7) 0.035Mean (SD) respiratory rate 51.9 (13.4) 51.6 (20.3) NSNo. (%) with history of apnea 23 (17.7) 23 (22.5) NSNo. (%) wheezing 47 (36.1) 34 (33.2) NSMean (% SD) pCO2 6.1 (1.4) 6.93 (2.35) 0.027Mean (SD) pH 7.36 (0.07) 7.33 (0.11) 0.040Mean (SD) SaO2 90.7 (8.7) 89.9 (12.2) NSNo. (%) on artificial ventilation 13 (10.0) 15 (14.7) NSNo. (%) with severe RSVb 51 (39.2) 46 (45.1) NSa Clinical data of patients were compared in a x2 test, Fisher’s exact test, orMann-Whitney U test when applicable. NS, no statistical difference.b Severe RSV infection was defined as meeting one or more of the followingcriteria: pCO2 . 6.6 kPa, SaO2 , 90%, and/or on artificial ventilation.3850 NOTES J. CLIN. MICROBIOL.Collectively, our data show that during a winter season whenrelatively many children are admitted during a relatively shortperiod, several strains may cocirculate in the population. Inaddition, it was shown that clinically more severe cases werefound spread over the branches of the phylogenetic tree.Therefore, severity of infection could not be attributed to par-ticular lineages of RSV.We thank Conny Kruyssen for assistance in preparing the manuscript.REFERENCES1. Anderson, L. J., J. C. Hierholzer, C. Tsou, R. M. Hendry, B. F. Fernie, Y.Stone, and K. McIntosh. 1985. Antigenic characterization of respiratorysyncytial virus strains with monoclonal antibodies. J. Infect. Dis. 151:626–633.2. Brandenburg, A. H., J. Groen, H. A. Van Steensel-Moll, E. J. C. Claas, P. H.Rothbarth, H. J. Neijens, and A. D. M. E. Osterhaus. 1997. Respiratorysyncytial virus specific serum antibodies in infants under six months of age:limited serological response upon infection. J. Med. Virol. 52:97–104.3. Cane, P. A., D. A. Matthews, and C. R. Pringle. 1992. Analysis of relatednessof subgroup A respiratory syncytial viruses isolated worldwide. Virus Res.25:15–22.4. Cane, P. A., D. A. Matthews, and C. R. Pringle. 1994. Analysis of respiratorysyncytial virus strain variation in successive epidemics in one city. J. Clin.Microbiol. 32:1–4.5. Cane, P. A., and C. R. Pringle. 1995. Evolution of subgroup A respiratorysyncytial virus: evidence for progressive accumulation of amino acid changesin the attachment protein. J. Virol. 69:2918–2925.FIG. 2. Phylogenetic dendrogram showing relatedness of group A isolates determined by sequence analyses of the first hypervariable region of the G protein.Isolates were selected from three consecutive seasons in the Sophia Children’s Hospital of Rotterdam. Seasons indicated are as follows: 1, 1992–1993; 2, 1993–1994;3, 1994–1995. For each isolate, the following patient characteristics are indicated. Severity of RSV infection: s, severe; m, mild. Severe was defined as meeting one ormore of the following criteria: pCO2 . 6.6 kPa, SaO2 , 90%, and a need for artificial ventilation. a.v., the need for artificial ventilation; apn., a history of apnea; age,the age in days upon admission.VOL. 38, 2000 NOTES 38516. Felsenstein, J. 1989. Phylip-Phylogeny Interference Package. Cladistics5:164–166.7. Fletcher, J. N., R. L. Smyth, H. M. Thomas, D. Ashby, and C. A. Hart. 1997.Respiratory syncytial virus genotypes and disease severity among children inhospital. Arch. Dis. Child. 77:508–511.8. Garcia, O., M. Martin, J. Dopazo, J. Arbiza, S. Frabasile, J. Russi, M.Hortal, P. Perez-Brena, I. Martinez, and B. Garcia-Barreno. 1994. Evolu-tionary pattern of human respiratory syncytial virus (subgroup A): cocircu-lating lineages and correlation of genetic and antigenic changes in the Gglycoprotein. J. Virol. 68:5448–5459.9. Glezen, W. P., L. H. Taber, A. L. Frank, and J. A. Kasel. 1986. Risk ofprimary infection and reinfection with respiratory syncytial virus. Am. J. Dis.Child. 140:543–546.10. Groothuis, J. R., K. M. Gutierrez, and B. A. Lauer. 1988. Respiratorysyncytial virus infection in children with bronchopulmonary dysplasia. Pedi-atrics 82:199–203.11. Hall, C. B., E. E. Walsh, C. E. Long, and K. C. Schnabel. 1991. Immunity toand frequency of reinfection with respiratory syncytial virus. J. Infect. Dis.163:693–698.12. Hall, C. B., E. E. Walsh, K. C. Schnabel, C. E. Long, K. M. McConnochie,S. W. Hildreth, and L. J. Anderson. 1990. Occurrence of groups A and B ofrespiratory syncytial virus over 15 years: associated epidemiologic and clin-ical characteristics in hospitalized and ambulatory children. J. Infect. Dis.162:1283–1290.13. Heikkinen, T., M. Waris, O. Ruuskanen, A. Putto-Laurila, and J. Mertsola.1995. Incidence of acute otitis media associated with group A and B respi-ratory syncytial virus infections. Acta Paediatr. 84:419–423.14. Hendry, R. M., A. L. Talis, E. Godfrey, L. J. Anderson, B. F. Fernie, and K.McIntosh. 1986. Concurrent circulation of antigenically distinct strains ofrespiratory syncytial virus during community outbreaks. J. Infect. Dis. 153:291–297.15. Johansen, J., L. S. Christensen, A. Hornsleth, B. Klug, K. S. Hansen, and M.Nir. 1997. Restriction pattern variability of respiratory syncytial virus duringthree consecutive epidemics in Denmark. APMIS 105:303–308.16. Johnson, P. R., M. K. Spriggs, R. A. Olmsted, and P. L. Collins. 1987. TheG glycoprotein of human respiratory syncytial viruses of subgroups A and B:extensive sequence divergence between antigenically related proteins. Proc.Natl. Acad. Sci. USA 84:5625–5629.17. Johnson, P. R., Jr., R. A. Olmsted, G. A. Prince, B. R. Murphy, D. W. Alling,E. E. Walsh, and P. L. Collins. 1987. Antigenic relatedness between glyco-proteins of human respiratory syncytial virus subgroups A and B: evaluationof the contributions of F and G glycoproteins to immunity. J. Virol. 61:3163–3166.18. Kneyber, M. C., A. H. Brandenburg, P. H. Rothbarth, R. de Groot, A. Ott,and H. A. Van Steensel-Moll. 1996. Relationship between clinical severity ofrespiratory syncytial virus infection and subtype. Arch. Dis. Child. 75:137–140.19. MacDonald, N. E., C. B. Hall, S. C. Suffin, C. Alexson, P. J. Harris, and J. A.Manning. 1982. Respiratory syncytial viral infection in infants with congen-ital heart disease. N. Engl. J. Med. 307:397–400.20. McConnochie, K. M., C. B. Hall, E. E. Walsh, and K. J. Roghmann. 1990.Variation in severity of respiratory syncytial virus infections with subtype.J. Pediatr. 117:52–62.21. McIntosh, E. D., L. M. De Silva, and R. K. Oates. 1993. Clinical severity ofrespiratory syncytial virus group A and B infection in Sydney, Australia.Pediatr. Infect. Dis. J. 12:815–819.22. Monto, A. S., and S. Ohmit. 1990. Respiratory syncytial virus in a communitypopulation: circulation of subgroups A and B since 1965. J. Infect. Dis.161:781–783.23. Mufson, M. A., R. B. Belshe, C. Orvell, and E. Norrby. 1988. Respiratorysyncytial virus epidemics: variable dominance of subgroups A and B strainsamong children, 1981–1986. J. Infect. Dis. 157:143–148.24. Mulholland, E. K., A. Olinsky, and F. A. Shann. 1990. Clinical findings andseverity of acute bronchiolitis. Lancet 335:1259–1261.25. Navas, L., E. Wang, V. de Carvalho, and J. Robinson. 1992. Improvedoutcome of respiratory syncytial virus infection in a high-risk hospitalizedpopulation of Canadian children. Pediatric Investigators Collaborative Net-work on Infections in Canada. J. Pediatr. 121:348–354.26. Parrott, R. H., H. W. Kim, J. O. Arrobio, D. S. Hodes, B. R. Murphy, C. D.Brandt, E. Camargo, and R. M. Chanock. 1973. Epidemiology of respiratorysyncytial virus infection in Washington, D.C. II. Infection and disease withrespect to age, immunologic status, race and sex. Am. J. Epidemiol. 98:289–300.27. Peret, T. C., C. B. Hall, K. C. Schnabel, J. A. Golub, and L. J. Anderson.1998. Circulation patterns of genetically distinct group A and B strains ofhuman respiratory syncytial virus in a community. J. Gen. Virol. 79:2221–2229.28. Russi, J. C., H. Chiparelli, A. Montano, P. Etorena, and M. Hortal. 1989.Respiratory syncytial virus subgroups and pneumonia in children. (Letterand comment.) Lancet 2:1039–1040.29. Salomon, H. E., M. M. Avila, M. C. Cerqueiro, C. Orvell, and M. Weissen-bacher. 1991. Clinical and epidemiologic aspects of respiratory syncytial virusantigenic variants in Argentinian children. (Letter.) J. Infect. Dis. 163:1167.30. Storch, G. A., L. J. Anderson, C. S. Park, C. Tsou, and D. E. Dohner. 1991.Antigenic and genomic diversity within group A respiratory syncytial virus.J. Infect. Dis. 163:858–861.31. Sullender, W. M., M. A. Mufson, L. J. Anderson, and G. W. Wertz. 1991.Genetic diversity of the attachment protein of subgroup B respiratory syn-cytial viruses. J. Virol. 65:5425–5434.32. Sullender, W. M., M. A. Mufson, G. A. Prince, L. J. Anderson, and G. W.Wertz. 1998. Antigenic and genetic diversity among the attachment proteinsof group A respiratory syncytial viruses that have caused repeat infections inchildren. J. Infect. Dis. 178:925–932.33. Taylor, C. E., S. Morrow, M. Scott, B. Young, and G. L. Toms. 1989.Comparative virulence of respiratory syncytial virus subgroups A and B.(Letter.) Lancet 1:777–778.34. Tsutsumi, H., M. Onuma, K. Nagai, H. Yamazaki, and S. Chiba. 1991.Clinical characteristics of respiratory syncytial virus (RSV) subgroup infec-tions in Japan. Scand. J. Infect. Dis. 23:671–674.35. Van Milaan, A. J., M. J. Sprenger, P. H. Rothbarth, A. H. Brandenburg, N.Masurel, and E. C. Class. 1994. Detection of respiratory syncytial virus byRNA-polymerase chain reaction and differentiation of subgroups with oli-gonucleotide probes. J. Med. Virol. 44:80–87.36. Walsh, E. E., K. M. McConnochie, C. E. Long, and C. B. Hall. 1997. Severityof respiratory syncytial virus infection is related to virus strain. J. Infect. Dis.175:814–820.37. Wang, E. E., B. J. Law, and D. Stephens. 1995. Pediatric InvestigatorsCollaborative Network on Infections in Canada (PICNIC) prospective studyof risk factors and outcomes in patients hospitalized with respiratory syncy-tial viral lower respiratory tract infection. J. Pediatr. 126:212–219.3852 NOTES J. CLIN. MICROBIOL.

English

G protein variation in respiratory syncytial virus group A does not correlate with clinical severity

NARCIS 

Respiratory syncytial virus group A strain variations of 28 isolates from
      The Netherlands collected during three consecutive seasons were studied by
      analyzing G protein sequences. Several lineages circulated repeatedly and
      simultaneously during the respective seasons. No relationships were found
      between lineages on the one hand and clinical severity or age on the
      other

Erasmus University Digital Repository

http://repub.eur.nl/pub/9476/11015418.pdf

G protein variation in respiratory syncytial virus group A does not correlate with clinical severity

Abstract

Similar works

Full text

Available Versions

EUR Research Repository

NARCIS

Erasmus University Digital Repository

EUR Research Repository