Andersen, Mikael Rørdam

Hansen, Bjarne Gram

Kildegaard, Helene Faustrup

Lund, Anne Mathilde

Mortensen, Uffe Hasbro

The development of the field of mammalian cell factories requests fast and high-throughput methods which means high need for simpler and more efficient cloning techniques. This project applies the ligation-free USERTM (uracil-specific excision reagent) cloning technique to construct mammalian expression vectors with maximum flexibility

Online Research Database In Technology

                       General rights Copyright and moral rights for the publications made accessible in the public portal are retained by the authors and/or other copyright owners and it is a condition of accessing publications that users recognise and abide by the legal requirements associated with these rights.  • Users may download and print one copy of any publication from the public portal for the purpose of private study or research. • You may not further distribute the material or use it for any profit-making activity or commercial gain • You may freely distribute the URL identifying the publication in the public portal   If you believe that this document breaches copyright please contact us providing details, and we will remove access to the work immediately and investigate your claim.     Downloaded from orbit.dtu.dk on: Dec 19, 2017A versatile expression vector system for mammalian cell factoriesLund, Anne Mathilde; Kildegaard, Helene Faustrup; Hansen, Bjarne Gram; Andersen, Mikael Rørdam;Mortensen, Uffe HasbroPublication date:2011Document VersionPeer reviewed versionLink back to DTU OrbitCitation (APA):Lund, A. M., Kildegaard, H. F., Hansen, B. G., Andersen, M. R., & Mortensen, U. H. (2011). A versatileexpression vector system for mammalian cell factories. Poster session presented at 6th Danish Conference onBiotechnology and Molecular Biology, Vejle, Denmark.AimThe development of the field of mammalian cell factories requests fast and high-throughput methods which means high need for simpler and more efficient cloning techniques. This project applies the ligation-free USERTM (uracil-specific exci-sion reagent) cloning technique to construct mammalian expression vectors with maximum flexibility.A versatile expression vector system for mammalian cell factories  Anne Mathilde Lund1, Helene Faustrup Kildegaard1, Bjarne Gram Hansen1,Mikael Rørdam Andersen1, Uffe Hasbro Mortensen1 1Center for Microbial Biotechnology, Department of Systems Biology, Technical University of Denmark, Kgs. Lyngby, DenmarkTCACGCTAATAGGAATPCR fragmentSuicide gene + USER cas.AGTGCGA UU ATCCTTAPCR product preparationPacI/Nt.BbvCI USER cassette ANt. BbvCINt. BbvCIPacIGCTGAGGGTTTAATTAAGTCCTCAGCCGACTCCCAAATTAATTCAGGAGTCGPacI/Nt.BbvCI USER cassette BNt. BbvCINt. BbvCIPacIGCTGAGGGTTTAATTAAGTCCTCAGCCGACTCCCAAATTAATTCAGGAGTCGDigestion (PacI and Nt. BbvCI)GCTGAGGGTTTAATCGACTTCAGCTAATTCAGGAGTCGRemoved by puricationTCAGCTAATTCAGGAGTCGGCTGAGGGTTTAATCGACTVector preparationCCCAAATTAAGTGCGATPCR fragmentPromoter T CACGCTAATAGGAATPCR fragmentSuicide gene + USER cas. TATCCTTAATTAAGTCCPCR fragmentPoly ATCAGCTAATTCAGGAGTCGGCTGAGGGTTTAATCGACTUSER    TMAGTGCGATPCR fragmentPromoter U CACGCTACCCAAATTAGGGTTTAA UTATCCTTAATAGGAALU PCR fragmentPoly AATTAAGTCCUAATTCAGGGCTGAGGGTTTAATCGACTTCAGCTAATTCAGGAGTCGAGTGCGATPCR fragmentPromoterCCCAAATTAGGGTTTAA CACGCTATCACGCTAATAGGAATPCR fragmentSuicide gene + USER cas.AGTGCGAATCCTTATATCCTTAPCR fragmentPoly AATTAAGTCCAATTCAGGATAGGAAincubation + E. coli transformationSV40 ori SE Enh Poly APKozak or TE TS MCS TAA(A/G) 3’UTR5’UTRORFPCS FUSPoly AP Neo ColE1AmpEukaryotic expression cassetteEukaryotic selection markerProkaryotic cassetteCloning strategyThe USERtm cloning is a ligation independent cloning technique. The method applies long complementary overhangs to anneal to each other to form a stable hybridisation product that can be used to transform E. coli without prior ligation. The overhangs on the PCR products are custom-made and their generation is restriction site-independent. Assembly of complex DNA constructs made of up several fragments can easily be fused seamlessly together. The method provides optimal flexibility. The selected cloning strategy is given in the figure below (1, 2).TMMammalian expression vector partsTraditionally mammalian expression vectors contain elements for expression in mammalian cells, selection in mammalian cells and their replication and selection in bacteria. Basic and optional vector parts which in principle easily could be inserted by USERTM are illu-strated below.TMBasic and optional components of a mammalian expression vector; Eukaryotic origin of replication (e.g. SV40 ori), structural elements (SE), enhancer (Enh), promoter (P), translational enhancer (TE), targeting signal (TS), Multiple clo-ning site (MCS) termination signal (TAA(A/G), open reading frame (ORF), pro-tease cleavage site (PCS), fusion protein or tag (FUS), selection marker (e.g. Neo), polyadenylation (polyA). Selection marker (Amp) and replication origin (ColE1) for E. coli (3).PerspectivesThe simplicity and flexibility of the USERTM cloning technique facilitate the adaption of the vector system into high-throughput cloning. Especially, fusion prote-ins and site-directed mutations are easily prepared. In the future, the system is planned to include site-specific integration and knockout cassettes. References1. Hansen BG et al. Versatile Enzyme Expression and Characterization System for Aspergillus nidulans, with the    the Penicillium brevicompactum Polyketide Synthase Gene from the Mycophenolic Acid Gene Cluster as a the   Test Case Appl Environ Microbiol. 2011 May;77(9):3044-51. 2.  Nour-Eldin, H.H. et al. USER cloning and USER fusion: the ideal cloning techniques for small and big labo-the    ratories. Methods Mol Biol. 2010;643:185-200.3. Bollati-Fogolín and Comini. Chapter 3 of Animal Cell Technology: From Biopharmaceutical to Gene the li Therapy, 2008. ISBN-13: 978-0415423045AcknowledgementThis project is funded by the Lundbeck Foundation. Thanks to Dorte Marie Koefoed Holm for assistance and providing the AsiSi/Nb.BtsI cassette with the  suicide gene-USER cassette. Thanks to the Danish Cancer Society for providing template plasmids and the HEK293 cell line. The cloning strategy for preparing a basic transient expression vector with a promoter, a USER cassette for gene insertion and a polyA tail. Analysis of promotor expression vectorsA vector libary of promotors with different expression levels is constructed by using the same primer tails at the different promotors. The functionality of the constructed vectors will be tested in CHO and HEK293 cell lines by insertion of eGFP as model protein.TMUSER    cloningTMPCR amplication of fragments with USER tail primers1. Constructed plasmid      sequenced2. Transient transfection of     mammalian cell lines3. Flow cytometry analysisIntegration of model gene by USER    cloningTMPoly AccdB/USER Promoter 1Promoter 2Promoter 3Strategy for preparing a basic transient expression vectors with promoter of different expression levels. The eGFP is used as model gene for analysis of expression+ +ororPromotor 1 PolyA Suicide gene/USER cas.eGFPPromotor 2 PolyA Suicide gene/USER cas.eGFPPromotor 3 PolyA Suicide gene/USER cas.eGFPTM

A versatile expression vector system for mammalian cell factories

http://orbit.dtu.dk/ws/files/59514067/prod21382434143366.Poster_2.pdf

A versatile expression vector system for mammalian cell factories

Abstract

Similar works

Full text

Available Versions

Online Research Database In Technology