Phytases are enzymes which hydrolyze phytate. Bacillus species are known to produce a thermostable phytase. The Bacillus subtilis strain NCIM-2712 was chosen for cloning of phy gene. Primers were designed for phy gene amplification using the phy gene sequence of B. subtilis (AF298179). A sequence of 1059 bp characteristic of phy gene was obtained on PCR amplification. This gene was cloned into InsT/A cloning vector and the positive clones were confirmed by colony PCR with gene specific primers and restriction digestion. Phytase is a promising candidate for feed applications. The cloned gene obtained in this study will have potential for producing recombinant enzyme, which would enhance the feed quality for poultry and piggery by supplementing it in their diets

Singh Rajput, Megha Kadam Bedekar, Sunil Kumar, Iti Gontia and Sharad Tiwari, Sunil Yadav, Keerti Tantwai*, Lalit

Journal of Phytology

English

Update Publishing (E-Journals)

Journal of Phytology 2011, 3(7): 35-37                                                                                ISSN: 2075-6240  www.scholarjournals.org                                                                                                    www.journal-phytology.com 35  Molecular Cloning of Phytase Gene from Bacillus subtilis NCIM-2712 Sunil Yadav, Keerti Tantwai*, Lalit Prasad Singh Rajput, Megha Kadam Bedekar, Sunil Kumar, Iti Gontia and Sharad Tiwari Biotechnology Centre, Jawaharlal Nehru Agricultural University, Jabalpur- 482004 (M.P.), India Article Info  Summary Article History  Phytases are enzymes which hydrolyze phytate. Bacillus species are known to produce a thermostable phytase. The Bacillus subtilis strain NCIM-2712 was chosen for cloning of phy gene. Primers were designed for phy gene amplification using the phy gene sequence of B. subtilis (AF298179). A sequence of 1059 bp characteristic of phy gene was obtained on PCR amplification. This gene was cloned into InsT/A cloning vector and the positive clones were confirmed by colony PCR with gene specific primers and restriction digestion. Phytase is a promising candidate for feed applications. The cloned gene obtained in this study will have potential for producing recombinant enzyme, which would enhance the feed quality for poultry and piggery by supplementing it in their diets.  Received : 16-02-2011  Revised : 18-03-2011  Accepted : 15-04-2011  *Corresponding Author  Tel : + 91-9407852309        Email:  tantwaik@yahoo.com   ©ScholarJournals, SSR  Key Words: Bacillus subtilis, phy gene, Cloning, Phytase    Introduction Phytase is widely present in nature occurring in microorganisms, plants as well as in some animal tissues. In bacteria, phytase activity has been found abundantly in Bacillus species like Bacillus sp. DS 11, B. amyloliquefaciens [1], B. subtilis VTTE-68013 [2], B. subtilis 168 and B. licheniformis [3]. The development of the B. subtilis cloning system has been mainly hindered by the absence of suitable vector replicons. Several plasmids can be introduced and maintained in the highly transformable B. subtilis strain 168 [4, 5] however, they lacked genetic markers for selection and DNA cloning. Bacterial phytase has been cloned and characterized from Escherichia coli [6]. Cloning of novel phytase gene from B. subtilis VTTE-68013 has also been reported [2]. Bacillus phytases differ from well characterized fungal phytase and other bacterial phytase possessing a six-bladed-propeller folding architecture and belong to β- propeller group [1, 3]. Unlike, other β-propeller structures, it does not show any conserved sequence repeat in the β-strands [7]. They have strict substrate specificity, thermostablity and exhibit a pH optimum in the range from 6.0 to 8.0 [8]. Metal dependency for structural integrity is another unique feature of β-propeller group of phytases. Although phytases from several species of bacteria, yeast, and fungi have been characterized, commercial production of these enzymes as feed additives currently focuses on Aspergilli and yeasts, as they are the most prolific extracellular producers of these enzymes [9, 10]. The role of phytase supplementation has been well proven and documented in poultry [11]. But, it is important to realize that any single phytase may never be able to meet the diverse needs for all commercial and environmental applications. Therefore, there is ongoing interest in screening microorganism for novel and efficient phytase. However, on the basis of strict substrate specificity, pH profile, resistance to proteolysis as well as high thermostability, bacterial phytases are a real alternative to fungal enzymes [12]. Particularly, Bacillus species have been reported to produce extracellular phytases [1, 2, 13, 14]. Hence, in the present investigation, the Bacillus subtilis NCIM-2712 strain was chosen to isolate and clone phy gene with a view to its over-expression in future endeavors.  Materials and Methods Strains and growth media:  Bacillus subtilis NCIM-2712 strain was procured from NCL, Pune, India. It was grown on the nutrient agar media and incubated at 37°C for 16 h. A single colony was inoculated in the nutrient broth medium and incubated at 37°C for 16 h at 180 rpm.   Amplification of phy gene using PCR:  Genomic DNA extraction from bacterial strain was carried out according to the standard protocol [15]. A set of forward and reverse primer to amplify the phy gene was designed by primer express software using the published phy gene sequence (AF298179). The primers were dissolved in TE to make a final working concentration of 25 pmol. The PCR amplification was carried out in 25 µl of total reaction volume using programmable thermal cycler (ABI, USA). PCR was optimized by testing various components of the reaction mixture in different concentrations viz., MgCl2 (1-3 mM), forward and reverse primers PhyF (5’CTGTCTGATCCTTATCATTT3’) and PhyR (5’ TCCGCTTCTGTCGGTCA 3’) (5 to 40 pmols) and annealing temperature (40-55°C). Amplification of the phy gene region was successfully achieved with initial denaturation at 95°C for 5 min followed by 35 cycles of denaturation, annealing and extension for 1 min at 95°C, 52°C and 72°C, respectively and the final extension was carried out at 72°C for 10 min. The PCR product was visualized on 1.0% (w/v) agarose gel and purified using ZymocleanTM gel DNA recovery kit (Zymo research, USA) following manufacturer’s instructions. Ligation of phy gene in cloning vector and transformation:  The ligation of amplified phy gene was carried out in InsT/A cloning vector (pTZ57R/T) (Fermentas) which is a Sunil Yadav et al./J. Phytol.  3 (2011) 35-37    36  convenient system for direct one step cloning of PCR-amplified DNA fragment. The ligation reaction mix was prepared as follows: 10.0 µl of purified PCR product, 1.5 µl of InsT/A cloning vector, 2.5 µl of ligase buffer, 1.0 µl of T4 ligase enzyme and 2.5 µl of PEG. The final volume was made to 25 µl with nuclease free water. Ligation reaction was carried out at 22°C for 12 h in thermomixer (Eppendorf, Hamburg, Germany) and the ligation mix was subsequently used for transformation. Transformation was carried out by mixing 10 µl of ligation product to 200 µl of the E. coli DH5α competent cells. The mixture was kept on ice for 1 h. Heat-shock was given for 45 s at 42°C and rapidly chilled on ice for 10 min. Upon transformation, 1 ml SOB, 20 µl glucose and 10 µl MgCl2 were added in to it and incubated at 37°C for 2 h with 180 rpm shaking. The transformed cells were spread on ampicillin (75 µg/ml) containing LB agar plate and incubated at 37°C for 18 h.  Screening of recombinant (InsT/A) clones having phy gene:  The colonies growing on LB plates containing ampicillin (75 µg/ml) were used to isolate plasmid DNA. The plasmid DNA was extracted adopting miniprep plasmid isolation method [15]. The confirmation of positive recombinant clones was carried out by colony PCR and restriction endonuclease digestion of the plasmids. A double digestion reaction was carried out for InsT/A-phy plasmid for the confirmation of the inserted phy gene using Sac-I and Hind-III enzymes. Results and Discussion Cloning of phy gene in InsT/A cloning vector:  PCR amplified 1059 bp phytase gene was ligated in InsT/A cloning vector as shown in Fig. 1. Construct was designated as InsT/A-phy. In the present study, transformation was done by using heat-shock method. Transformed colonies growing on LB agar- ampicillin plate are shown in Fig. 2. Initial confirmation of the insertion of amplified phy gene into the cloning vector was done by colony PCR. The colony PCR with phy gene specific primers revealed a PCR product of 1059 bp indicating successful transformation (Fig. 3). For further confirmation of positive clones, a double restriction digestion with Sac-I and Hind-III enzymes was carried out and the cloned fragment of 1059 bp was observed (Fig. 4).                     Figure 1. Cloning strategy for inserting PCR amplified phy gene in InsT/A cloning vector [Source: www.fermentas.com]            Figure 2. LB-agar ampicillin plate showing transformed E. coli DH5α colonies having InsT/A- phy construct. Figure 3. 1% agarose gel electrophoresis showing colony PCR amplified 1059 bp phy gene from clone; M–1Kb DNA Molecular weight marker, L1–Colony PCR amplified product of phy gene. Figure 4. 1% agarose gel electrophoresis showing restriction digestion analysis of InsT/A-phy clone containing 1059 bp gene insert by Sac-I and Hind-III enzymes; M1–1Kb DNA Molecular weight marker, L1–PCR amplified product of phy gene, L2–RE digested clone, L3–Lineralized InsT/A vector.   The first bacterial phytase gene cloning was reported for appA gene, from E. coli which encodes periplasmic phosphoanhydride phosphohydrolase [16]. Molecular gene cloning of phytase gene has also been reported from B. amyloliquifaciens FZB45 [17], Pseudomonas syringae MOK1 into E. coli using pGEMT–easy vector [18], B. subtilis US417 Sunil Yadav et al./J. Phytol.  3 (2011) 35-37    37  [14], partial phy gene of 989 bp from B. subtilis VTTE-68013 [2]. The recovery of active phytase enzyme from inclusion bodies and characterization of the recombinant phytase produced from cloning and expression of a novel phytase gene from Bacillus sp. in E. coli was also achieved [19].  Conclusion  Use of plant-based feed in poultry and piggery is inevitable in the near future too. Phytate-rich plant ingredients restrict the bioavailability of phosphorus along with other minerals, thereby increasing discharge of phosphorus into water bodies leading to eutrophication. However, it is evident that phytase supplementation of feed improves the bioavailability of the phosphorus and nitrogen. The increased bioavailability of nitrogen and phosphorus in the diet leads to reductions in feed costs through curtailing the addition of inorganic phosphorus. The role of phytase supplementation has been well proven and documented in poultry. The identified and confirmed InsT/A-phy clone will be helpful for further over-expression of this gene for large scale production of cost effective phytase enzyme through fermentation and their utilization in animal feed.  Acknowledgement The authors would like to express their gratitude to Director Research Services, Jawaharlal Nehru Agricultural University, Jabalpur for successful completion of the research work. References [1] Kim Y.O., J.K. Lee, H.K. Kim, J.H. Yu, T.K. Oh. 1998. Cloning of the thermostable phytase gene (phy) from Bacillus sp. DS11 and its over expression in Escherichia coli. FEMS Microbiol. Lett., 162: 185-191. [2] Kerovuo J., M. Lauraeus, P. Nurminen, N. Kalkkinen J. Apajalahti. 1998. Isolation, characterization, molecular gene cloning and sequencing of a novel phytase from Bacillus subtilis. Appl. Environ. Microbiol., 64: 2079-2085. [3] Tye A.J., F.K. Siu, T.Y. Leung, B.L. Lim. 2002. Molecular cloning and the biochemical characterization of two novel phytase from Bacillus subtilis 168 and Bacillus licheniformis. Appl. Microbiol. Biotechnol., 59: 190-197.  [4] Lovett P.S., E.J. Duvall, K.M. Keggins. 1976. Bacillus pumilus plasmid pPL10: properties and insertion into Bacillus subtilis 168 by transformation. J. Bacteriol., 127: 817-828.  [5] Tanaka T., M. Kuroda, K.J. Sakaguchi. 1976. DNA cloning in Bacillus subtilis. Bacteriology, 129: 1487-1494. [6] Greiner R., U. Konietzny, K.D. Jany. 1993. Purification and characterization of two phytases from Escherichia coli. Arch. Biochem. Biophys., 303: 107-113. [7] Shin S., N.C. Ha, B.C. Oh, T.K. Oh, B.H. Oh. 2001. Enzyme mechanism and catalytic property of β- propeller phytase. Structure, 9: 851-858. [8] Konietzny U., R. Greiner. 2004. Bacterial phytase: potential application, in vivo function and regulation of its synthesis. Braz. J.  Microbiol., 35: 11-18. [9] Vohra A., T. Satyanarayana. 2003. Phytases: microbial sources, production, purification, and potential biotechnological applications. Crit. Rev. Biotechnol. 23: 29-60. [10] Haefner S., A. Knietsch, E. Scholten, J. Braun, M. Lohscheidt, O. Zelder. 2005. Biotechnological production and applications of phytases. Appl. Microbiol. Biotechnol., 68: 588–597. [11] Lan G.Q., N. Abdullah, S. Jalaludin, Y.W. Ho. 2002. Efficacy of supplementation of a phytase-producing bacterial culture on the performance and nutrient use of broiler chickens fed corn-soybean meal diets. Poul. Sci. 81: 1522–1532. [12] Elkhalil E.A., K. Manner, R. Borriss, O. Simon. 2007. In vitro and in vivo characteristics of bacterial phytases and their efficacy in broiler chickens. Brit. Poult. Sci. 48: 64-70.  [13] Gulati H.K., B.S., Chadha H.S. Saini. 2007. Production and characterization of thermostable alkaline phytase from Bacillus laevolacticus isolated from rhizosphere soil. J. Indus. Microbiol. Biotech., 34: 91-98.  [14] Farhat A., H. Chouayekh,  M. Farhatben,  K. Bouchaala, S. Bejar. 2008. Gene cloning and characterization of a thermostable phytase from Bacillus subtilis US417 and assessment of its potential as a feed additive in comparison with a commercial enzyme. Mol.  Biotechnol., 64: 1234-1245. [15] Sambrook, J., D.W. Russel. 2001. Molecular cloning: A laboratory manual. Cold Spring Harbor Laboratory Press, New York: A8.40-A8.54. [16] Dassa J., C. Marck, P.L. Boquet. 1990. The complete nucleotide sequence of the E. coli gene appA reveals significant homology between pH 2.5 acid phosphatase and glucose-1-phosphatase. J. Bacteriol., 172: 5497-5500. [17] Idriss E.E., O. Makarewicz, A. Farouk, K. Rosner, R. Greiner, H. Bochow, T. Richter, R. Borriss. 2002. Extracellular phytase activity of Bacillus amyloliquefaciens FZB45 contributes to its plant-growth promoting effect. Microbiology, 148: 2097-2109. [18] Cho J., C. Lee, S. Kong, J. Lee, H. Lee, J. Bok, J. Woo, Y. Moon, Y. Choi. 2005. Molecular cloning of a phytase gene (PhyM) from Pseudomonas syringae MOK1. Curr. Microbiol., 51: 11-15. [19] Rao D.E.C.S., K.V. Rao, V.D. Reddy. 2008. Cloning and expression of Bacillus phytase gene (phy) in Escherichia coli and recovery of active enzyme from the inclusion bodies. J. Appl. Microbiol., 23: 1365-1368.   

Molecular Cloning of Phytase Gene from Bacillus subtilis NCIM-2712

https://doaj.org/article/3263d1af8293491694efc4f0cef087fd

Molecular Cloning of Phytase Gene from Bacillus subtilis NCIM-2712

Abstract

Similar works

Full text

Available Versions

Update Publishing (E-Journals)

Update Publishing (E-Journals)