Vasoactive intestinal polypeptide (VIP) is a putative neurotransmitter of the inhibitory non-adrenergic non-cholinergic nervous system and influences the mammalian airway function in various ways. Hence known for bronchodilatory, immunomodulatory and mucus secretion modulating effects by interacting with the VIP receptors VPAC1 and VPAC2, it is discussed to be a promising target for pharmaceutical intervention in common diseases such as COPD and bronchial asthma. Here we examined the expression and transcriptional regulation of VPAC1 in the lungs of allergic mice using an ovalbumin (OVA) -induced model of allergic asthma. Mice were sensitized to OVA and challenged with an OVA aerosol. In parallel a control group was sham sensitized with saline. VPAC1 expression was examined using RT-PCR and real time-PCR studies were performed to quantify gene transcription. VPAC1 mRNA expression was detected in all samples of OVA-sensitized and challenged animals and control tissues. Further realtime analysis did not show significant differences at the transcriptional level.

Although the present studies did not indicate a major transcriptional regulation of VPAC1 in states of allergic airway inflammation, immunomodulatory effects of VPAC1 might still be present due to regulations at the translational level

Braun, Armin

Groneberg, Jan David Alexander

Lauenstein, Hans-Dieter

Quarcoo, David

Welte, Tobias

English

Hochschulschriftenserver - Universität Frankfurt am Main

RESEARCH Open AccessExpression of VPAC1 in a murine model ofallergic asthmaHans D Lauenstein1,2, David Quarcoo3, Tobias Welte1, Armin Braun2 and David A Groneberg3*AbstractVasoactive intestinal polypeptide (VIP) is a putative neurotransmitter of the inhibitory non-adrenergic non-cholinergic nervous system and influences the mammalian airway function in various ways. Hence known forbronchodilatory, immunomodulatory and mucus secretion modulating effects by interacting with the VIP receptorsVPAC1 and VPAC2, it is discussed to be a promising target for pharmaceutical intervention in common diseasessuch as COPD and bronchial asthma. Here we examined the expression and transcriptional regulation of VPAC1 inthe lungs of allergic mice using an ovalbumin (OVA) -induced model of allergic asthma. Mice were sensitized toOVA and challenged with an OVA aerosol. In parallel a control group was sham sensitized with saline. VPAC1expression was examined using RT-PCR and real time-PCR studies were performed to quantify gene transcription.VPAC1 mRNA expression was detected in all samples of OVA-sensitized and challenged animals and control tissues.Further realtime analysis did not show significant differences at the transcriptional level.Although the present studies did not indicate a major transcriptional regulation of VPAC1 in states of allergic airwayinflammation, immunomodulatory effects of VPAC1 might still be present due to regulations at the translational level.Keywords: VIP, VPAC1, Neurotransmitter, Asthma, AllergyIntroductionRespiratory diseases constitute a major part of occupationaldiseases. Next to asbestosis [1,2] and tuberculosis [3,4],bronchial asthma belongs to leading causes of the globalburden of occupational lung disease [5-7] and further in-sights into the underlying mechanisms of the disease areneeded. Among these mechanisms, pathways of the neuro-immune axis may play a key role. In this respect, vasoactiveintestinal peptide (VIP) is a putative neurotransmitter oft h en o n - a d r e n e r g i cn o n - c h o l i n e r g i cn e r v o u ss y s t e mi nt h erespiratory tract [8]. VIP-immunoreactivity is present incells of the tracheobronchial smooth muscle layer, in thewalls of pulmonary and bronchial vessels, around submuco-sal glands, in the lamina propria and in pulmonary ganglia[8,9]. VIP immuno reactive nerve fibres are found asbranching networks in the respiratory tract [8] and they aredecreasing in frequency as the airways become smaller, butextend to peripheral bronchiols [10,11]. VIPergic nerves arecolocalized with cholinergic nerves and VIP immunoreac-tivity is also present in sensory nerves [8,12].VIP is a highly abundent and pleiotrophic mediator,known for various effects, including bronchodilatation,modulation of mucus secretion and immunomodulation.VIP is therefore a promising target for future therapy inchronic inflammatory lung diseases [13].VIP binds predominantly to the two VIP-receptorsVPAC1 and VPAC2. Antiinflammatory effects have beendemonstrated to be mediated by the VPAC1 receptorin vivo and in vitro. VPAC1 activation was shown to in-hibit the release of inflammatory mediators from macro-phages like IL-6, TNF-alpha, IL-12 and NO and increaseof IL-10 in a murine model of septic shock. In contrastto VPAC2, VPAC1 also inhibits the proliferation of acti-vated T cells and the expression of costimulatory mole-cules like B7.1 and B7.2 [14]. A reduction of VPAC1expression could be shown for T cells in case of activa-tion [15].Since VPAC1 was suggested to play the major role in theantiinflammatory action of VIP [16] and anti-inflammatoryeffects were recently described for the receptor PAC1, thepresent study assessed the expression and regulation of the* Correspondence: arbsozmed@med.uni-frankfurt.de3Institute of Occupational Medicine, Social Medicine and EnvironmentalMedicine, Medical School, Goethe-University Frankfurt, Frankfurt, GermanyFull list of author information is available at the end of the article© 2013 Lauenstein et al.; licensee BioMed Central Ltd. This is an open access article distributed under the terms of theCreative Commons Attribution License (http://creativecommons.org/licenses/by/2.0), which permits unrestricted use,distribution, and reproduction in any medium, provided the original work is properly cited.Lauenstein et al. Journal of Occupational Medicine and Toxicology 2013, 8:28http://www.occup-med.com/content/8/1/28receptor VPAC1 [17] in a murine model of asthma on thetranscriptional level.Material and methodsAsthma Model and preparation of lung tissue samplesFemale BALB/c mice were sensitized to ovalbumin(OVA) as previously described [17] by administration of10 μg OVA and 1,5 mg Alum (Pierce, Rockford, USA) in50 μL saline by intraperitoneal injection on days 0, 14and 21 (n= 16) (Figure 1). The allergic response in therespiratory tract was induced by the exposition of miceto 1% OVA aerosol for 20 min on days 27 and 28.24 hours after the last challenge the mice were sacrificedby an overdose of Narcoren, (Merial, Hallbergmoos,Germany). Lungs were then removed. The upper rightlobe was dissected and snap frozen in liquid nitrogen.The samples were stored at −80°C until further analysis.The animal study was performed according to inter-nationally recognized guidelines and approved by thelocal authorities (Hannover).Generation of cDNAAs previously described [17], the lung samples were ho-mogenized using fastprep (Bio101, Carlsbad, USA) andtotal RNA was isolated using the RNeasy mini kit (Qiagen,Hilden, Germany) according to the customer’s manual.Quantity of RNA was controlled photometrically by OD260/280 nm.900 ng RNA were transcribed into cDNA using theomniscript RT-PCR kit (Qiagen, Hilden, Germany).RNA was denatured at 65°C for 5 minutes. After coolingto room temperature, buffer RT, random primers, RNaseinhibitor, and omniscript for the RT-PCR were added.The RNA was transcribed at 37°C for 90 min and the re-action was stopped by heating up to 95°C for 5 min.Each RNA sample was used for two approaches: Firstfor the RT-PCR and in a second approach as a RNAcontrol for genomic DNA contamination in which sam-ples were treated like the RT-PCR samples but withoutthe transcriptase. Both, the cDNA and the RNA controlwere immediately used for the real time-PCR.Quantitative real time PCRThe relative amounts of cDNA were quantified using theLight Cycler Fast Start SYBR Green Kit (Roche, Mann-heim, Germany) according to the customer’sp r o t o c o l .Porphobilinogen deaminase (PBGD) was used as a housekeeping gene. The DNA was amplified using the followingconditions: 10 in 95°C; 45 cycles 1 s 95°C, 10 s 68°C, 9 s72°C. The pureness of the products was verified via amelting curve. The products were visualized via gelelectrophoresis.All primers were produced by MWG (Ebersberg,Germany) and designed intron spanning to exclude theamplification of genomic DNA in case of contamina-tions. The PCR products were verified by DNA agarosegel and by sequencing by the company GATC biotech(Koblenz, Germany). The primer sequences are shownin Table 1.Results and discussionSpecific PCR products for VPAC1 and PBGD werefound in the lungs of both, the OVA sensitized and thesaline sensitized control group. The products were iden-tified to be specific by gel electrophoresis (Figure 2) andby melting curve analysis (data not shown).To assess quantitative changes of VPAC1 mRNA ex-pression, the VPAC1 fluorescence signal was normalizedto the house keeping gene PBGD using the program relquant (Roche) and displayed as relative unit. Though thereal time PCR results tend to show a slight increase ofVPAC1 expression in the lungs of OVA sensitized ani-mals compared to the sham sensitized group (Figure 3),no significant difference can be detected using statisticalapproaches.Although a clear alteration in the VPAC 1 expressionon RNA level could not be detected in the present study,differential VPAC1 expression in terms of inflammatorymechanisms had been shown before. In this respect, inan in vitro model with different subsets of T cell subsetsthe VPAC1 expression was linked to an inhibition ofproliferation and the expression of costimulatory mole-cules [14]. VPAC1 was also shown to be downregulatedin case of activation of T cells [15].Figure 1 Treatment protocol for the murine asthma model; OVA sensitization via i.p administration of 10 mg OVA on days 0, 14 and21 followed by aerosolic challenges with an 1% OVA aerosol for 20 min on days 27 and 28; sacrifice on day 29.Lauenstein et al. Journal of Occupational Medicine and Toxicology 2013, 8:28 Page 2 of 4http://www.occup-med.com/content/8/1/28VPAC1 expression was shown in various cells of theimmune system like T cells and B cells in other compart-ments of the body such as the intestinal system [18].Also the infiltration of these VPAC1-positive cells duringan inflammation like in ulcerative colitis and crohn’s dis-ease was shown to increase the amount of VPAC1 posi-tive cells in the inflammed tissue [18].According to literature it could be hypothesized, thatVPAC1 might play a role in the pathogenesis of bron-chial asthma, for effects mediated by VPAC1 are presentin allergic diseases such as asthma or atopic dermatitis.Nevertheless we did not find a regulation of VPAC1 onthe transcriptional level so far. Therefore, it is necessaryto take a more detailed look into the lung tissue on thesingle cellular level and VPAC1 positive cells and the ex-pression of VPAC1 should be quantified for each cellpopulation separately. Overlaps of alterations in VPAC1expression in specific cell populations by the influx ofVPAC1 positive cells could thereby avoided. Also, regu-lation may take place at the level of translation and fu-ture studies should access this aspect.Interestingly, the VPAC1 related receptor PAC1 wasrecently shown to be differentially expressed in a murinemodel of ovalbumin-induced asthma [17]. In this studyan increased PAC1R mRNA expression was present inlung tissue under allergic conditions. In the state of anasthmatic reaction, PAC1R-deficient mice (PAC1R(−/−))and to BALB/c mice treated with the specific PAC1Ragonist maxadilan, PAC1R deficiency resulted in in-creased inflammatory effects, while agonistic stimulationof It was therefore concluded that anti-inflammatory ef-fects can be achieved via PAC1 receptor and thatPAC1receptor agonists may represent a promising targetfor an anti-inflammatory therapy.In summary, the present analysed the expression andtranscriptional regulation of VPAC1 in a murine modelof allergic asthma using an established ovalbumin proto-col. While VPAC1 mRNA expression was detected in allsamples realtime analysis did not show significant differ-ences at the transcriptional level. Therefore further stud-ies should quantify VPAC1 expression on the level ofsingle respiratory cells using modern tools of biochemis-try [19], molecular biology [20], cell biology [21][22] andmorphology [23].Competing interestsThe authors declare that they have no competing interests.Authors’ contributionsHDL, DQ, TW, AB, DAG have made substantial contributions to theconception and design of the study, acquisition of the data andinterpretation. HDL, DQ, TW, AB, DAG have been involved in drafting andrevising the manuscript. All authors have read and approved the finalmanuscript.AcknowledgementSupported by a grant of the Deutsche Forschungsgemeinschaft: SFB 587 -Immune reactions of the Lung in Infection and Allergy.Author details1Department of Pulmonary Medicine, Hannover Medical School, Hannover,Germany.2Fraunhofer Institute of Toxicology and Experimental Medicine,Hannover, Germany.3Institute of Occupational Medicine, Social Medicineand Environmental Medicine, Medical School, Goethe-University Frankfurt,Frankfurt, Germany.Received: 11 October 2012 Accepted: 30 September 2013Published: 10 October 2013Table 1 Primer sequencesGene Primer forward Primer reverse ProductsizePBGD cacgatcctgaaactctgct agatggtccagaagatgaccc 224PAC1 ttcactactgcgtggtgtccaact atatcccagcatcccgcatcatca 228Figure 2 VPAC1 gel electrophoresis; L= 100 bp DNA ladder;arrows point at 200 bp band; slot 1=OVA sensitized (OVs)PBGD; slot 2= OVs VPAC1; slot 3= sham sensitized (SHs) PBGD;slot 4=SHs VPAC1; slot 5=OVs PBGD RNA control (RC); slot 6=OVs VPAC1 RC; slot 7=SHs PBGD RC; slot 8=SHs VPAC1 RC;expected products: PBGD=224 bp; VPAC1=228 bp.Figure 3 Normalized ratio of VPAC1 expression in lung tissue;VPAC1 fluorescence signal normalized to PBGD; OVs = OVAsensitized and challenged group, SHs = sham sensitized group.Lauenstein et al. Journal of Occupational Medicine and Toxicology 2013, 8:28 Page 3 of 4http://www.occup-med.com/content/8/1/28Reference1. Wilken D, Velasco Garrido M, Manuwald U, Baur X: Lung function inasbestos-exposed workers, a systematic review and meta-analysis.J Occup Med Toxicol 2011, 6:21.2. Alexopoulos EC, Bouros D, Dimadi M, Serbescu A, Bakoyannis G, Kokkinis FP:Comparative analysis of induced sputum and bronchoalveolar lavagefluid (BALF) profile in asbestos exposed workers. J Occup Med Toxicol2011, 6:23.3. Moucaut A, Nienhaus A, Courtois B, Nael V, Longuenesse C, Ripault B, RucayP, Moisan S, Roquelaure Y, Tripodi D: The effect of introducing IGRA toscreen French healthcare workers for tuberculosis and potentialconclusions for the work organisation. J Occup Med Toxicol 2013, 8:12.4. Nienhaus A, Costa JT: Screening for tuberculosis and the use of aborderline zone for the interpretation of the interferon-gamma releaseassay (IGRA) in Portuguese healthcare workers. J Occup Med Toxicol 2013,8:1.5. Baur X: A compendium of causative agents of occupational asthma.J Occup Med Toxicol 2013, 8:15.6. Baur X, Barbinova L: Occupational airborne exposure, specificsensitization and the atopic status: evidence of a complexinterrelationship. J Occup Med Toxicol 2013, 8:2.7. Baur X, Bakehe P, Vellguth H: Bronchial asthma and COPD due to irritantsin the workplace - an evidence-based approach. J Occup Med Toxicol2012, 7:19.8. Maggi CA: The mammalian tachykinin receptors. Gen Pharmacol 1995,26:911–944.9. Groneberg DA, Springer J, Fischer A: Vasoactive intestinal polypeptide asmediator of asthma. PulmPharmacol Ther 2001, 14:391–401.10. Lundberg JM, Fahrenkrug J, Hokfelt T, Martling CR, Larsson O, Tatemoto K,Anggard A: Co-existence of peptide HI (PHI) and VIP in nerves regulatingblood flow and bronchial smooth muscle tone in various mammalsincluding man. Peptides 1984, 5:593–606.11. Lundberg JM, Fahrenkrug J, Larsson O, Anggard A: Corelease of vasoactiveintestinal polypeptide and peptide histidine isoleucine in relation toatropine-resistant vasodilation in cat submandibular salivary gland.Neurosci Lett 1984, 52:37–42.12. Groneberg DA, Quarcoo D, Frossard N, Fischer A: Neurogenic mechanismsin bronchial inflammatory diseases. Allergy 2004, 59:1139–1152.13. Groneberg DA, Rabe KF, Fischer A: Novel concepts of neuropeptide-baseddrug therapy: vasoactive intestinal polypeptide and its receptors. Eur JPharmacol 2006, 533:182–194.14. Delgado M, Gomariz RP, Martinez C, Abad C, Leceta J: Anti-inflammatoryproperties of the type 1 and type 2 vasoactive intestinal peptidereceptors: role in lethal endotoxic shock. Eur J Immunol 2000,30:3236–3246.15. Sun W, Hong J, Zang YC, Liu X, Zhang JZ: Altered expression of vasoactiveintestinal peptide receptors in T lymphocytes and aberrant Th1immunity in multiple sclerosis. Int Immunol 2006, 18:1691–1700.16. Delgado M, Ganea D: Vasoactive intestinal peptide and pituitaryadenylate cyclase-activating polypeptide inhibit antigen-inducedapoptosis of mature T lymphocytes by inhibiting Fas ligand expression.J Immunol 2000, 164:1200–1210.17. Lauenstein HD, Quarcoo D, Plappert L, Schleh C, Nassimi M, Pilzner C,Rochlitzer S, Brabet P, Welte T, Hoymann HG, et al: Pituitary adenylatecyclase-activating peptide receptor 1 mediates anti-inflammatory effectsin allergic airway inflammation in mice. Clin Exp Allergy 2011, 41:592–601.18. Yukawa T, Oshitani N, Yamagami H, Watanabe K, Higuchi K, Arakawa T:Differential expression of vasoactive intestinal peptide receptor1 expression in inflammatory bowel disease. Int J Mol Med 2007,20:161–167.19. De Vries A, Engels F, Henricks PA, Leusink-Muis T, McGregor GP, Braun A,Groneberg DA, Dessing MC, Nijkamp FP, Fischer A: Airway hyper-responsiveness in allergic asthma in guinea-pigs is mediated by nervegrowth factor via the induction of substance P: a potential role for trkA.Clin Exp Allergy 2006, 36:1192–1200.20. Groneberg DA, Doring F, Nickolaus M, Daniel H, Fischer A: Expression ofPEPT2 peptide transporter mRNA and protein in glial cells of rat dorsalroot ganglia. Neurosci Lett 2001, 304:181–184.21. Springer J, Scholz FR, Peiser C, Groneberg DA, Fischer A: SMAD-signaling inchronic obstructive pulmonary disease: transcriptional down-regulationof inhibitory SMAD 6 and 7 by cigarette smoke. Biol Chem 2004,385:649–653.22. Eynott PR, Groneberg DA, Caramori G, Adcock IM, Donnelly LE, KharitonovS, Barnes PJ, Chung KF: Role of nitric oxide in allergic inflammation andbronchial hyperresponsiveness. Eur J Pharmacol 2002, 452:123–133.23. Groneberg DA, Peiser C, Dinh QT, Matthias J, Eynott PR, Heppt W, CarlstedtI, Witt C, Fischer A, Chung KF: Distribution of respiratory mucin proteins inhuman nasal mucosa. Laryngoscope 2003, 113:520–524.doi:10.1186/1745-6673-8-28Cite this article as: Lauenstein et al.: Expression of VPAC1 in a murinemodel of allergic asthma. Journal of Occupational Medicine and Toxicology2013 8:28.Submit your next manuscript to BioMed Centraland take full advantage of: • Convenient online submission• Thorough peer review• No space constraints or color ﬁgure charges• Immediate publication on acceptance• Inclusion in PubMed, CAS, Scopus and Google Scholar• Research which is freely available for redistributionSubmit your manuscript at www.biomedcentral.com/submitLauenstein et al. Journal of Occupational Medicine and Toxicology 2013, 8:28 Page 4 of 4http://www.occup-med.com/content/8/1/28

Expression of VPAC1 in a murine model of allergic asthma

Abstract

Similar works

Full text

Available Versions

Hochschulschriftenserver - Universität Frankfurt am Main