The current study was conducted to isolation one type of surface protein of Streptococcus pyogens this protein separated using partially purification method. Purifiction  process include precipitation of crude  M protein  one peak of this protein was appeared, the best precipitate rate was 30% . PCR assay were performed to identify the presence of some genes related to pathogenicity in bacteria responsible from Tonsillitis .Streptococcus pyogens represented the largest causative agent of inflammation of the tonsil so the study revealed the presence of certain gene in some isolate of bacteria, including the gene SpeB that gave large proportions in the study isolates 12 out of 37 at a rate of (32.4%). Keywords : S.pyogens , Tonsillitis , M protein ,PCR ,Spe

Abid, Abdalnabi J

Jabur, Mohammad A

Nabat, Zainab N

English

International Institute for Science, Technology and Education (IISTE): E-Journals

Advances in Life Science and Technology                                                                                                 www.iiste.org ISSN 2224-7181 (Paper) ISSN 2225-062X (Online) Vol.28, 2015  46 Partially Purification M Protein from Streptococcus Pyogens and Molecular Study of Some Virulence Factors  Abdalnabi J Abid1      Mohammad A Jabur2      Zainab N Nabat1 1.Dept. Of Biology, Coll. Of Science for Women, Univ. Of Babylon-Iraq 2.Dept. Of  Biology , Coll. Of Science , Univ. Of Babylon Corresponding author e-mail :dr_almamory59@yahoo.com  Abstract The current study was conducted to isolation one type of surface protein of Streptococcus pyogens this protein separated using partially purification method. Purifiction  process include precipitation of crude  M protein  one peak of this protein was appeared, the best precipitate rate was 30% . PCR assay were performed to identify the presence of some genes related to pathogenicity in bacteria responsible from Tonsillitis .Streptococcus pyogens represented the largest causative agent of inflammation of the tonsil so the study revealed the presence of certain gene in some isolate of bacteria, including the gene SpeB that gave large proportions in the study isolates 12 out of 37 at a rate of (32.4%).                                    Keywords : S.pyogens , Tonsillitis , M protein ,PCR ,SpeB  Introduction  M proteins are cell-surface attached proteins that are composed of two polypeptide chains that forms an alpha-helical, coiled-coil configuration .They have an LPXTG motif at their carboxyl terminal part. This protein Confers S. pyogenes with the property to resist killing in human blood. The M proteins occur in pairs, twisted around each other in a coiled coil structure (Fischetti et al, .1990). The major virulence factor reported in GAS is the M protein encoded by emm gene. The M protein confers resistance to phagocytosis by polymorph nuclear leukocytes (Oehmcke et al, .2004). M-protein belongs to a large pathogenicity island that was probably acquired before the S. pyogenes speciation. Its potential instability could have practical implications for species identification in the clinical laboratory (Pahlman et al., 2008).SpeB gene is a chromosomally located on every GAS strains and has cysteine protease activity (James et al, .2002) which enables evasion of innate immunity via degradation of complement factors (Honda-Ogawa et al, .2013). It carries laminin- binding activity of the bacteria, it is not only secreted molecule but also occurs unexpectedly tightly bound to the bacterial surface (Hytonen et al,.2001).SpeB is the predominant extracellular protein in streptococcal culture supernatant and secreted as a 42-kDa zymogen and auto catalyzed into an active 28-kDa cysteine protease It cleaves or degrades host extracellular matrix, immunoglobulins, complement components, and even GAS surface adhesions (M protein and protein F1), C5a peptidase, and several secreted proteins  (Chen et al,.2003).and tumor necrosis factor-β, with weak T helper 2 cytokines responses (Cunningham, 2008).  Material and Method  Detection presence of M protein  M protein was detected in GAS by using the indirect bacterial test as follows: Serial dilution 10-1 to 10-8 was conducted for testing bacteria which grown for 18 hours. 0.1 ml of each dilution was pipetted onto plates with blood- brain heart infusion media; spread with a glass spreader and incubated at 37 ºC for 18 hours, then we calculated the number of living cells. After that, 0.1 ml of each dilution was transferred to sterile plan tubes (duplicate), then 0.4 ml of blood of healthy persons which considered the source of phagocyte cells. One of the tubes was incubated at shaker incubator for 20 RPM/min and the other was incubated at 37 ºC for 3 hours. 0.1 ml of fixed and mobile treatment was pipetted onto plates with blood- brain heart infusion media using sterile spreader and incubation at 37ºC for 18 hours. The numbers of living cells were calculated and the test is positive when the growth in symmetric treatment (Lancefield and Perlmann, 1952).  Partially purification M protein from Streptococcus pyogens       Crude M protein was extracted by limited pepsin digestion according to the method of (Manjula and Fischetti, 1980).  Determination of protein Concentration    :  The protein concentration was determined according to Bradford (1976) method.                                                                  Advances in Life Science and Technology                                                                                                 www.iiste.org ISSN 2224-7181 (Paper) ISSN 2225-062X (Online) Vol.28, 2015  47  Figure (1): Standard curve of protein concentration. Ammonium sulphate precipitation The ammonium sulfate was added in different saturation ratio (30%,40% 50%  60%)to reach the optimum ratio of ammonium sulfate by adding gradually the amount of salt to each 25 ml protein solution in ice bath and magnetic stirrer for 1hour ,the procedure include centrifugation the solution at 3500xg for 10 minutes. The supernatant was dropped while the precipitate was dissolved in minimum volume of phosphate buffer (0.01 PH, 8). Gel Filtration Chromatography: Separation and purification protein was caring out using sphedaxG-200gel method. Preparation of sephadex G-200 gel The preparation of gel was achieved as recommended by supplied company, since by take 3gram from gel sephadex G-200 was suspended in 105ml D.W and put in water bath at 90 °C for 5hours then wash twice with phosphate buffer prepared in (3-7-3), after that the gel was suspended in amount of the same buffers, then the gel was degassed by using vacuum pump, the gel was packaged gently in glass Colum with dimension (1.5x16.5). The Colum was equilibrated using same buffers which used in gel. Molecular Assay DNA Extraction A single colony of Streptococcus pyogens, which had been incubated overnight, transfer to sterile Brain heart infusion Broth and incubated at 37 ◦C for 24 hour. The DNA extracted using the genomic DNA purification kit (Geneied) according to manufacturing instructions. PCR assay A PCR (Polymerase Chain Reaction) is performed in order to make a large number of copies of a gene. Otherwise, the quantity of DNA is insufficient and cannot be used for other methods of testing. A PCR is performed on an automated cycler, which heats and cools the tubes with the reaction mixture in a very short time. PCR is performed in three major steps denaturation ,annealing  and extension. SpeB gene One gene primer for Streptococcus pyogens virulence factor was used for genetic detection of these bacteria, this gene is SpeB. Sequence and size product of this primer found in table 1.  Table (1): Primer used in PCR References Sequences Product size (pb) Primer name (Naglaa et al,.2014) 5’GTAGCAACACATCCTGTAGCTGCA’3 5’AGGTGCAC GAAGCG CAG AAG ATAT’3  423 SpeB F SpeB R  The reaction mixture Amplification of DNA was carried out in a final volume of 20µl containing master mix (Bioneer) , SpeB primer and the bacterial extracted DNA with a volume pointed in table 2.     y = 0.0015x + 0.001R² = 0.944700.020.040.060.080.10.120.140.160 20 40 60 80 100 120Absorbance at 595 nmConcentration µg / mlAdvances in Life Science and Technology                                                                                                 www.iiste.org ISSN 2224-7181 (Paper) ISSN 2225-062X (Online) Vol.28, 2015  48 Table (2):  Protocols of PCR reaction mixture volumes Volume Content s of reaction mixtures NO 5 µl Master mix 1 2.5 µl Forward primer 2 2.5 µl Reveres primer 3 5 µl DNA template 4 5 µl Nuclease free water 5  Thermal reaction Cycling Conditions Reaction processes for each gene in thermal cycle was differing in type of gene .Specificity and reference recommendation as follow:  Table (3) Thermal cycling conditions. NO. of cycles Time Temperature steps 1 3min 94 °C 1- Initial denaturation 3 7s 94 °C 2- Denaturation 25 10s 55 °C 3- Annealing 2 5s 72 °C 4- Elongation 2 3min 72 °C 5- Final elongation 1 α 4 °C 6-Hold  Results Purification of M protein Ammonium sulphate precipitation The crude extract of M protein was precipitated by ammonium sulphate precipitation method . Results of this study showed that 30% of the crude extract M protein is best ratio for  precipitate from Streptococcus pyogens.  Gel filtration chromatography for M protein When the ammonium sulphate precipitated, M protein solution was passed through sephadex G-200 Colum that equilibrated with phosphate buffer (0.01 M, pH 8), the fraction was collected and measured at 280 nm absorbency, one peak of protein was appeared, and one peak is M protein show in figure (2)  Figure (2) Gel filtration chromatography using G-200 Colum (1.5x16.5) for purification M protein from Streptococcus pyogens with 0.01M and PH 8 phosphate buffer, flow rate 36ml/60min and fraction volume 3ml.  Molecular study Because of Streptococcus pyogens appear to be predominant bacterial in tonsillitis samples .These isolates were applied in genetic study.DNA was extracted for all S.pyogens isolates and the DNA concentrated was measured using Nano drop apparatus. DNA samples that show positivity for DNA concentration were used for searching for SpeB. Molecular study reveals12 positive isolates from 37 samples (32.4%). -0.00500.0050.010.0150.020.0250.030.0350.040.0450 20 40 60 80Absorbance at 280nm   number fractionAdvances in Life Science and Technology                                                                                                 www.iiste.org ISSN 2224-7181 (Paper) ISSN 2225-062X (Online) Vol.28, 2015  49 SpeB gene The SpeB gene considered virulence factor gene for Streptococcus pyogens and used for diagnosis Streptococcus pyogens and molecular weight for423.Positive results for amplification this gene that gave large proportions in the study isolates 12 out of 37 at a rate of (32%) figure (3)  Figure (3) 2% Agarose Gel Electrophoresis of423bp PCR products of  SpeB gene, lane M represent 2000bp molecular marker, lane 1, 2, 3, 4, 5,6, 7,8,9,10,11,12 represent sample no. of positive results .  Discussion Purification of M protein In this study was showed 30% the best ratio to precipitate because it gave highly phagocytosis. These results agreed with (Edwin et al, .1977). The ammonium sulphate was used in enzyme or protein precipitation because of its highly solubility and cheap cost compared with the other salts - unaffected in PH and enzyme equilibrating the charges found in protein surface and disruption of the water layer surrounding it that leads to its precipitation. Gel filtration chromatography by using sephadex G-200 Colum was the next step of M protein purification after the step of ammonium sulphate precipitation. The results showed one peak of protein, one peak mean that only found M protein this result is agreements with (Dahee et al,.2002). Sephadex G-200 has many advantages included fast run, high recovery separation, simple preparation and its stability for long time permits reusing of the gel many times in protein separation (Thomas, 2011).  Molecular study SpeB gene is virulence factor used for diagnosis of Streptococcus pyogens results found 12 isolates out of 37 at rate (32.4%) positive result and molecular weight 423pb this study is correlated with (Santos et al,.2003) who found SpeB isolates is (25%) in contrast with (Dmitrieva et al,.2000) who found SpeB isolates (69%) .  References Bradford,M.M.(1976).A Rapid and Sensitive Method for the Quantitation of Microgram Quantities of Protein Utilizing the Principle of protein-Dye Binding .Analytical Biochemistry .72:248-254. Chen, C.Y.; Luo, S.Cand Kuo ,S.C.(2003): Maturation processing  and characterization of streptopain. J. Biol Chem. 278: 17336-17343.  Cunningham, M.W. (2008).Pathogenesis of groups A streptococcal infections and their and their sequelae.J. Adv Exp Med Biol. 609:29-42. Dahee, M.A.;Yousif,S.Y and Mustafa(20002).Protein –M-extraction from locally isolated Streptococcus pyogens,.j.Iraq science .43(2):26-43. Dmitrieva ,N.F.; Trofimov, D.I.u .;Eshchina,A.S.; Riapis ,L.A.; Pavlova, O.G.; Petrova ,T.V.;Skorkina, I.u.A.; Gerasimov, A.N.; Alekseev,L.P.; Zhuravlev ,M.Vand Briko ,N.I. (2002).Frequency of genes speA, speB, and spec in Streptococcus pyogenes strains and the identification of the infective agent by polymerase chain reaction .j. Microbiol Epidemiol Immunobiol. 5:3-6. Edwin,H.;Beachey, M.D .;Gene,H.and Stolleraman,M.D(1977).Toxic effects of Streptococcal M protein on platelets and polymorphoneuclear leukocytes in human blood.J.experimental medicine .134:351-365. Fischetti, V.A. (1990). Streptococcal M protein: molecular design and biological behavior. J.Clin Microbial Advances in Life Science and Technology                                                                                                 www.iiste.org ISSN 2224-7181 (Paper) ISSN 2225-062X (Online) Vol.28, 2015  50 Rev .2: 285–314. James, C. S.; Kent, K. E.; Judy, A. D.;George, V. L. and James, M. M. (2002). Molecular analysis of group A streptococcus type emm18 isolates temporally associated with acute rheumatic fever outbreaks in Salt Lake city, Utah. J. Clin. Microbial.40: 1805-1810. Honda-Ogawa, M.; Ogawa, T.; Terao, Y.;Sumitomo ,T.; Nakata, M.; Ikebe, K.; Maeda,Y.and Kawabata, S.(2013) .Cysteine proteinase from Streptococcus pyogenes enables evasion of innate immunity via degradation of complement factors. J Biol Chem. May 31; 288(22): 15854-15864.     Hytonen ,J.; Haataja ,S.; Gerlach ,D.;Podbielski .A. and Finne ,J.(2001).The SpeB virulence factor of Streptococcus pyogenes, multifunctional secreted and cell surface molecule with strep adhesion,Laminin-binding and cysteine protease activity.J. Mol Microbiol . 39 (2): 512-519. Lancefield.R.C and Perlmann,G.E (1952).Preparation and properties of type specific Mantigen isolation from group A. type 1 hemolytic Streptococcus.J.Exp.Med.96:71-82. Manjula,B.N and fischetti ,V.A.(1980).Studies on group A streptococcal-M-proteins. Purification of type M5 proteins and comparision of its amino terminal sequences with two immunological unrelated –M-protein molecules .J.Immunol.124 (1):261-276. Naglaa, F. G.; Wesam ,H. A. and Mohammed, S.h (2014). speB Gene as an Early Specific Genetic Marker for Diagnosis of Group A Beta-Hemolytic Streptococcus (GABHS). Considerable virulence factor J. Egyptian Medical Microbiology .23(1):99-108. Oehmcke, S.; Podbielski ,A.and Kreikemeyer ,B. (2004). Function of the Fibronectin binding serum opacity factor of Streptococcus pyogenes in adherence to epithelial cells. Infect Immun. 72:4302-4308. Pahlman, L.;Olin,A.L.; Darenberg,J.;Morgelin,M.;Kotb,M.; Herwald, and A. Norrby-Teglund. (2008). Soluble M1 protein of Streptococcus pyogenes triggers potent T cell activation. J.Cell Microbial. 10: 404-414. Santos, O.; Weckx, L.L.L.M.;PignatariA.A.C. and Pignatari S.S.N.( 2003).Detection of Group A Beta-Hemolytic Streptococcus Employing Three Different ,Braz. J. Infect Dis ,7(5):297-300. Thomas, M. D. (2010). Seventh edition ,Text Book of Biochemistry With clinical correlation, Wiley – liss, Drexel University, Inc.Pubilication, USA.        The IISTE is a pioneer in the Open-Access hosting service and academic event management.  The aim of the firm is Accelerating Global Knowledge Sharing.  More information about the firm can be found on the homepage:  http://www.iiste.org  CALL FOR JOURNAL PAPERS There are more than 30 peer-reviewed academic journals hosted under the hosting platform.   Prospective authors of journals can find the submission instruction on the following page: http://www.iiste.org/journals/  All the journals articles are available online to the readers all over the world without financial, legal, or technical barriers other than those inseparable from gaining access to the internet itself.  Paper version of the journals is also available upon request of readers and authors.   MORE RESOURCES Book publication information: http://www.iiste.org/book/ Academic conference: http://www.iiste.org/conference/upcoming-conferences-call-for-paper/   IISTE Knowledge Sharing Partners EBSCO, Index Copernicus, Ulrich's Periodicals Directory, JournalTOCS, PKP Open Archives Harvester, Bielefeld Academic Search Engine, Elektronische Zeitschriftenbibliothek EZB, Open J-Gate, OCLC WorldCat, Universe Digtial Library , NewJour, Google Scholar   

Partially Purification M Protein from Streptococcus Pyogens and Molecular Study of Some Virulence Factors

The current study was conducted to isolation one type of surface protein of Streptococcus pyogens this protein separated using partially purification method. Purifiction process include precipitation of crude M protein one peak of this protein was appeared, the best precipitate rate was 30 %. PCR assay were performed to identify the presence of some genes related to pathogenicity in bacteria responsible from Tonsillitis.Streptococcus pyogens represented the largest causative agent of inflammation of the tonsil so the study revealed the presence of certain gene in some isolate of bacteria, including the gene SpeB that gave large proportions in the study isolates 12 out of 37 at a rate of (32.4%)

Partially Purification M Protein from Streptococcus Pyogens and Molecular Study of Some Virulence Factors

Abstract

Similar works

Full text

Available Versions

International Institute for Science, Technology and Education (IISTE): E-Journals

CiteSeerX