We identified 11 polymorphic microsatellite loci in collared lizards (Crotaphytus collaris). Polymorphism assessment in 512 individuals from 52 populations sampled across much of the species distribution revealed a fairly high degree of genetic diversity (six to 20 alleles per locus) and a wide range of average expected heterozygosity values (0.143–0.530). We found no evidence for linkage, very few deviations from HW expectation (two of 572 possible population/locus analyses) and thus no evidence for null alleles. There was a tendency for reduced polymorphism towards the northern periphery

Brisson, Jennifer A.

Cummings, Shawn

Hutchison, Delbert W.

Strasburg, Jared L.

English

UNL | Libraries

University of Nebraska - Lincoln 
DigitalCommons@University of Nebraska - Lincoln 
Faculty Publications in the Biological Sciences Papers in the Biological Sciences 
2004 
Isolation and characterization of 11 polymorphic microsatellite 
loci in collared lizards (Crotaphytus collaris) 
Delbert W. Hutchison 
Whitman College, Walla Walla, WA, hutchidw@whitman.edu 
Jared L. Strasburg 
Washington University, St. Louis, MO 
Jennifer A. Brisson 
University of Nebraska-Lincoln, jennifer.brisson@rochester.edu 
Shawn Cummings 
St. Louis, MO 
Follow this and additional works at: https://digitalcommons.unl.edu/bioscifacpub 
 Part of the Life Sciences Commons 
Hutchison, Delbert W.; Strasburg, Jared L.; Brisson, Jennifer A.; and Cummings, Shawn, "Isolation and 
characterization of 11 polymorphic microsatellite loci in collared lizards (Crotaphytus collaris)" (2004). 
Faculty Publications in the Biological Sciences. 73. 
https://digitalcommons.unl.edu/bioscifacpub/73 
This Article is brought to you for free and open access by the Papers in the Biological Sciences at 
DigitalCommons@University of Nebraska - Lincoln. It has been accepted for inclusion in Faculty Publications in the 
Biological Sciences by an authorized administrator of DigitalCommons@University of Nebraska - Lincoln. 
Collared lizards (Crotaphytus collaris) are medium-
sized heliothermic predators that inhabit rocky out-
crops throughout their extensive range from the south-
western US and northern Mexico eastward through 
Oklahoma into the Flint Hills of Kansas and the Ozark 
Plateau of southern Missouri and northern Arkan-
sas (McGuire 1996). Environmental conditions impor-
tant to collared lizard survival and reproductive fit-
ness vary widely across this geographical expanse. As 
a result, populations face varying selective and demo-
graphic forces in different parts of the range—making 
this an interesting group within which to investigate 
genetic structure (Hranitz & Baird 2000; Campbell & 
McCoy 2002), regional patterns of variability (Hutchi-
son 2003) or the effects of habitat degradation (Temple-
ton et al. 2001; Brisson et al. 2003). These animals also 
make excellent subjects for investigating social behav-
ior or reproductive success due to dramatic sexual di-
morphism in coloration, behavior, and territoriality 
(Baird et al. 1996). 
Access to polymorphic microsatellite loci would 
greatly enhance the effectiveness of any of these inves-
tigations. To this end, we isolated 20 μg of whole ge-
nomic DNA from a single collared lizard sampled in 
southwestern Missouri using standard phenol-chlo-
roform extraction (Bruford et al. 1992). This DNA was 
used to construct two libraries, one nonenriched and 
one enriched. For the nonenriched library (described in 
Hutchison 1997), the DNA was digested with BamHI, 
size sorted (200–600 bp), ligated into pUC19 vector and 
transformed into DH5α cells. Subsequent colonies were 
screened twice with CA8, CAC5, and GACA4 oligonucle-
otides to yield loci Orig6, Orig7, Orig11, Orig21, Orig24, 
Orig25, and Orig26 (from the original screening) and 
N5 (from the second screening). Construction of the en-
riched library followed a protocol designed by S. Cum-
mings based on instructions provided with the streptav-
idin-coated magnetic beads (Promega™) with frequent 
reference to Sambrook et al. (1989). Whole genomic DNA 
was digested with Sau3AI, ligated into pUC19 vector 
and subjected to polymerase chain reaction (PCR) with 
pUC19 primers 1224 and 1233. Product was mixed with 
streptavidin-coated magnetic beads attached to oligo-
nucleotides CAG5 or CCT5 to locate PCR products with 
these motifs. After separation from the beads, the prod-
ucts were again digested with Sau3AI, ligated back into 
pUC19 vectors and transformed into DH5α cells. Result-
ing “enriched” colonies were harvested and sequenced 
to identify loci Enri3, Enri21 and Enri48. For all 11 loci, 
primers flanking the microsatellite repeats (Table 1) 
were designed using oligo shareware and guidelines in 
Hoelzel & Green (1992). 
Published in Molecular Ecology Notes 4 (2004), pp. 554–556; doi: 10.1111/j.1471-8286.2004.00730.x  Copyright  © 2004 Blackwell Publishing Ltd. 
Used by permission.
Submitted March 26, 2004; revised May 28, 2004; accepted May 28, 2004.
p r i m e r  n o t e
Isolation and characterization of 11 polymorphic  
microsatellite loci in collared lizards (Crotaphytus collaris) 
Delbert W. Hutchison,* Jared L. Strasburg,† Jennifer A. Brisson,† and Shawn Cummings ‡
* Biology Department, Whitman College, Walla Walla, WA, 99362, USA, 
† Department of Biology, Campus Box 1137, Washington University, St. Louis, MO 63130, USA, 
‡ 7205 Delta Avenue, St. Louis, MO, 63117, USA
Corresponding author — D. W. Hutchinson, fax 509 527-5904, email hutchidw@whitman.edu 
Abstract
We identified 11 polymorphic microsatellite loci in collared lizards (Crotaphytus collaris). Polymorphism assess-
ment in 512 individuals from 52 populations sampled across much of the species distribution revealed a fairly 
high degree of genetic diversity (six to 20 alleles per locus) and a wide range of average expected heterozygosity 
values (0.143–0.530). We found no evidence for linkage, very few deviations from HW expectation (two of 572 pos-
sible population/locus analyses) and thus no evidence for null alleles. There was a tendency for reduced polymor-
phism towards the northern periphery. 
Keywords: Crotaphytus collaris, genetic variation, microsatellites, peripheral populations, population structure
554
11 polymorphic microsatellite loci in collared lizards (C. Collaris)   555
Microsatellite loci were amplified using locus-specific 
conditions optimized for buffer, annealing temperature, 
and amplification cycles (Table 1). Fragments were am-
plified with fluorescently labelled forward primers and 
visualized using a BaseStation DNA Fragment Ana-
lyzer (MJ Research). Polymorphism was assessed using 
genomic DNA isolated from 512 collared lizards sam-
pled at 52 sites across the species range (mean = 8.13 
animals/population). All 11 loci reported here were 
polymorphic (six to 20 alleles per locus) and amplified 
reliably, although there was variability in their perfor-
mance. Loci Orig6, Orig25 and Enri3 exhibited a ten-
dency to form poly-A tails. Fortunately, this is remedied 
by adding a 30 minute extension of 72°C at the end of 
the PCR run. Loci Orig7 and N5 stuttered, but in each 
case the true band is much greater in amplitude than 
false bands. Population analyses with the gda computer 
program (Lewis & Zaykin 1996), revealed a range of av-
erage heterozygosity values (0.143–0.530) across all 52 
populations. Furthermore, no linkage disequilibrium 
was evident between any of the loci, despite the fact that 
Loci Orig24 and Orig25 are only separated by 138 base 
pairs. Bonferroni analyses (Rice 1989) showed only two 
populations, of 572 possible population/locus combi-
nations, deviated significantly from Hardy–Weinberg 
expectations, thus giving little evidence for null alleles 
(Chakraborty et al. 1992). 
Workers interested in using these loci should be 
aware of potential geographical trends in polymor-
phism in some of the loci. For example, although all 
loci were variable across the species range, nine (all but 
Orig25 and N5) exhibited lower levels of heterozygosity 
towards the northern periphery of the range. However, 
correlation analyses between levels of heterozygosity 
and latitude showed this trend was significant (5% level) 
for only six loci (Orig6, Orig11, Orig21, Orig24, Orig26, 
and Enri21), while only three remained significant af-
ter Bonferroni analyses (Orig11, Orig24, and Orig26). 
Table 1. Temp (PCR annealing temperature), Buffers (PCR buffer; see below), Notes (locus-specific information; see below), n 
(number of individuals surveyed for variability); HO and HE (observed and expected heterozygosity values, respectively, aver-
aged across all populations) 
                                                                                                                 Temp                 # alleles          Notes 
Locus      Primer Sequence (bp)                                         Motif         (°C)    Buffer   (size range)      (1–4)        n             HO           HE           GenBank # 
Orig6  For: AGGACACAAACATTCTTATC (20)  CA9  46  C  7 (138–150)  1  441  0.265  0.348  AY567818 
 Rev: TCTGAGTATTCCTTGCTT (18)  perfect 
Orig7  For: AGGTTGTGGTCTGTAGCA (18)  CA24  55  B  16 (199–229)  2  208  0.222  0.270  AY567819 
 Rev: GGATCTGTCCCAATAATG (18)  imperfect 
Orig11  For: CACTATAAGATGTAGCACTTGC (22)  CA8  56  D  7 (169–182)   256  0.091  0.162  AY567820 
 Rev: GGTAAGCACCAGATTGAGC (19)  perfect 
Orig21  For: GGGGTTGGAGCAAAGAG (17)  CA11  TD  C  17 (126–160)  3  190  0.160  0.223  AY567821 
 Rev: AAGCCCCGGAAGAAAAG (17)  perfect  (62–50) 
Orig24  For: AGTTGAACTCGATGCTCT (18)  GACA10  52  D  16 (144–204)  4  276  0.323  0.400  AY567822 
 Rev: ATTGAACCCATGGTAAAG (18)  imperfect 
Orig25  For: AGCCTTTACTGTGAGACCCA (20)  ATT10  51  D  12 (109–154)  1,4  313  0.354  0.417  AY567822 
 Rev: TCATGAAATGAAGCAAAATTAATAATA (27)  perfect 
Orig26  For: TATACATTCTTGAGTTCCGC (20)  CA8  54  J  20 (99–139)   329  0.294  0.324  AY567823 
 Rev: CAATGAGGGATATAAGGTGG (20)  perfect 
Enr3  For: CCTCAGCAGAAGCACCAGC (19)  CAG6  60  D  6 (101–116)  1  311  0.175  0.209  AY567824 
 Rev: TATTGAGCAGGACAGGGAAG (20)  perfect 
Enr21  For: AGGAAGGCTCAAAGGTTAC (19)  CCT6  60  D  6 (99–114)   453  0.378  0.350  AY567825 
 Rev: ATTTCACACAGGAGGAGGAGG (21)  perfect 
Enr48  For: TTTGTTCTTATTTTACTTGCGT (22)  CA13  50  A  11 (107–127)   394  0.412  0.530  AY567826 
 Rev: AGGTATTGTGCTGTCTGAGG (20)  perfect 
N5  For: CTGCCATATCATGAAGGGTG (20)  AT16  56  J  17 (166–198)  2  106  0.070  0.143  AY567827 
 Rev: AATCAGCACACTGGGAAAG (19)  perfect 
Buffers:  A − 200 mm Tris (pH 8.4), 250 mm KCl, 15 mm MgCl2  
B − 200 mm Tris (pH 8.4), 250 mm KCl, 25 mm MgCl2  
C − 200 mm Tris (pH 8.4), 500 mm KCl, 15 mm MgCl2  
D − 200 mm Tris (pH 8.4), 500 mm KCl, 25 mm MgCl2 
J  − 200 mm Tris (pH 9.2), 250 mm KCl, 25 mm MgCl2 
Notes:  1 = Poly A (add 30 minute, 72°C  extension)  
2 = Stutters, but readable since one peak much higher  
3 = TD refers to touchdown PCR  
4 = Physically linkage between loci 25 and 25 (no evidence of linkage disequilibrium)
556  hutchison et al. in MoleCular eCology Notes  4 (2004)
Thus, these three loci may prove less useful than others 
as measures of genetic variability in peripherally located 
populations. 
Acknowledgments
This work was funded by a National Science Foundation grant 
to Alan R. Templeton (DEB-9610219), an NSF Research Op-
portunity Award to DWH (#DEB-0108874–002), and Howard 
Hughes Medical Institute Predoctoral Fellowships to JLS and 
JAB. We also wish to thank the Missouri Departments of Con-
servation and Natural Resources. 
References
Baird T. A., Acree M. A., Sloan C. L. (1996) Age and gender-
related differences in the social behavior and mating suc-
cess of free-living collared lizards, Crotaphytus collaris. Co-
peia 1996: 2, 336– 347. 
Brisson J. A., Strasburg J. L., Templeton A. R. (2003) Impact 
of fire management on the ecology of collared lizard (Cro-
taphytus collaris) populations living on the Ozark Plateau. 
Animal Conservation, 6, 247–254. 
Bruford M. W., Hanotte O., Brookfield J. F. Y., Burke T. (1992) 
Single-locus and multilocus DNA fingerprinting. In: Molec-
ular Genetic Analyses of Populations: a Practical Approach (ed. 
Hoelzel AR), pp. 225–266. IRL Press, Oxford. 
Campbell J. H., McCoy J. K. (2002) Mitochondrial DNA analy-
sis of gene flow among six populations of collared lizards 
(Crotaphytus collaris) in west central Texas. Texas Journal of 
Science, 54, 151–162. 
Chakraborty R., De Andrade M., Daiger S. P., Budowle R. 
(1992) Apparent heterozygosity deficiencies observed in 
DNA typing data and their implications in forensic appli-
cations. Annals of Human Genetics, 56, 45–57. 
Hoelzel A. R., Green A. (1992) Analysis of population-level 
variation by sequencing PCR- amplified DNA. In: Molec-
ular Genetic Analyses of Populations: a Practical Approach (ed. 
Hoelzel AR), pp. 159–187. IRL Press, Oxford. 
Hranitz J. M., Baird T. A. (2000) Effective population size and 
genetic structure of a population of collared lizards, Cro-
taphytus collaris, central Oklahoma. Copeia 2000: 3, 786–791. 
Hutchison D. W. (1997) Population genetic consequences of 
the Holocene invasion of the Ozarks and Flint Hills by the 
eastern collared lizard (Crotaphytus collaris collaris) with 
subsequent habitat fragmentation. PhD Thesis, Washing-
ton University in St. Louis. 
Hutchison D. W. (2003) Testing the central/peripheral model: 
Analyses of microsatellite variability in the eastern col-
lared lizard (Crotaphytus collaris collaris). American Midland 
Naturalist, 149, 148–162. 
Lewis P. O., Zaykin D. (1996) Genetic Data Analysis, v, 1.0 (d6) 
for Windows 95/NT. Available at: http://lewis.eeb.uconn.
edu/lewishome   
McGuire J. A. (1996) Phylogenetic Systematics of Crotaphytid Liz-
ards (Reptilia: Iguania: Crotaphytidae). Bulletin of the Carne-
gie Museum of Natural History, Number. 32. Carnegie In-
stitute, Pittsburgh, USA. 
Rice W. R. (1989) Analyzing tables of statistical tests. Evolution, 
43, 223–225. 
Sambrook J., Fritsch E., Maniatis T. (1989) Molecular Cloning. 
A Laboratory Manual, 2nd ed. Cold Spring Harbor Labora-
tory, New York. 
Templeton A. R., Robertson R. J., Brisson J., Strasburg J. (2001) 
Disrupting evolutionary processes: The effect of habitat 
fragmentation on collared lizards in the Missouri Ozarks. 
Proceedings of the National Academy of Sciences of the USA, 
98, 5426–5432. 
Crotaphytus collaris, Stegall Mountain, Missouri (Alan Templeton & National Park Service)


Isolation and characterization of 11 polymorphic microsatellite loci in collared lizards (\u3ci\u3eCrotaphytus collaris\u3c/i\u3e)

DigitalCommons@University of Nebraska

University of Nebraska - Lincoln DigitalCommons@University of Nebraska - Lincoln Faculty Publications in the Biological Sciences Papers in the Biological Sciences 2004 Isolation and characterization of 11 polymorphic microsatellite loci in collared lizards (Crotaphytus collaris) Delbert W. Hutchison Whitman College, Walla Walla, WA, hutchidw@whitman.edu Jared L. Strasburg Washington University, St. Louis, MO Jennifer A. Brisson University of Nebraska-Lincoln, jennifer.brisson@rochester.edu Shawn Cummings St. Louis, MO Follow this and additional works at: https://digitalcommons.unl.edu/bioscifacpub  Part of the Life Sciences Commons Hutchison, Delbert W.; Strasburg, Jared L.; Brisson, Jennifer A.; and Cummings, Shawn, "Isolation and characterization of 11 polymorphic microsatellite loci in collared lizards (Crotaphytus collaris)" (2004). Faculty Publications in the Biological Sciences. 73. https://digitalcommons.unl.edu/bioscifacpub/73 This Article is brought to you for free and open access by the Papers in the Biological Sciences at DigitalCommons@University of Nebraska - Lincoln. It has been accepted for inclusion in Faculty Publications in the Biological Sciences by an authorized administrator of DigitalCommons@University of Nebraska - Lincoln. Collared lizards (Crotaphytus collaris) are medium-sized heliothermic predators that inhabit rocky out-crops throughout their extensive range from the south-western US and northern Mexico eastward through Oklahoma into the Flint Hills of Kansas and the Ozark Plateau of southern Missouri and northern Arkan-sas (McGuire 1996). Environmental conditions impor-tant to collared lizard survival and reproductive fit-ness vary widely across this geographical expanse. As a result, populations face varying selective and demo-graphic forces in different parts of the range—making this an interesting group within which to investigate genetic structure (Hranitz & Baird 2000; Campbell & McCoy 2002), regional patterns of variability (Hutchi-son 2003) or the effects of habitat degradation (Temple-ton et al. 2001; Brisson et al. 2003). These animals also make excellent subjects for investigating social behav-ior or reproductive success due to dramatic sexual di-morphism in coloration, behavior, and territoriality (Baird et al. 1996). Access to polymorphic microsatellite loci would greatly enhance the effectiveness of any of these inves-tigations. To this end, we isolated 20 μg of whole ge-nomic DNA from a single collared lizard sampled in southwestern Missouri using standard phenol-chlo-roform extraction (Bruford et al. 1992). This DNA was used to construct two libraries, one nonenriched and one enriched. For the nonenriched library (described in Hutchison 1997), the DNA was digested with BamHI, size sorted (200–600 bp), ligated into pUC19 vector and transformed into DH5α cells. Subsequent colonies were screened twice with CA8, CAC5, and GACA4 oligonucle-otides to yield loci Orig6, Orig7, Orig11, Orig21, Orig24, Orig25, and Orig26 (from the original screening) and N5 (from the second screening). Construction of the en-riched library followed a protocol designed by S. Cum-mings based on instructions provided with the streptav-idin-coated magnetic beads (Promega™) with frequent reference to Sambrook et al. (1989). Whole genomic DNA was digested with Sau3AI, ligated into pUC19 vector and subjected to polymerase chain reaction (PCR) with pUC19 primers 1224 and 1233. Product was mixed with streptavidin-coated magnetic beads attached to oligo-nucleotides CAG5 or CCT5 to locate PCR products with these motifs. After separation from the beads, the prod-ucts were again digested with Sau3AI, ligated back into pUC19 vectors and transformed into DH5α cells. Result-ing “enriched” colonies were harvested and sequenced to identify loci Enri3, Enri21 and Enri48. For all 11 loci, primers flanking the microsatellite repeats (Table 1) were designed using oligo shareware and guidelines in Hoelzel & Green (1992). Published in Molecular Ecology Notes 4 (2004), pp. 554–556; doi: 10.1111/j.1471-8286.2004.00730.x  Copyright  © 2004 Blackwell Publishing Ltd. Used by permission.Submitted March 26, 2004; revised May 28, 2004; accepted May 28, 2004.p r i m e r  n o t eIsolation and characterization of 11 polymorphic  microsatellite loci in collared lizards (Crotaphytus collaris) Delbert W. Hutchison,* Jared L. Strasburg,† Jennifer A. Brisson,† and Shawn Cummings ‡* Biology Department, Whitman College, Walla Walla, WA, 99362, USA, † Department of Biology, Campus Box 1137, Washington University, St. Louis, MO 63130, USA, ‡ 7205 Delta Avenue, St. Louis, MO, 63117, USACorresponding author — D. W. Hutchinson, fax 509 527-5904, email hutchidw@whitman.edu AbstractWe identified 11 polymorphic microsatellite loci in collared lizards (Crotaphytus collaris). Polymorphism assess-ment in 512 individuals from 52 populations sampled across much of the species distribution revealed a fairly high degree of genetic diversity (six to 20 alleles per locus) and a wide range of average expected heterozygosity values (0.143–0.530). We found no evidence for linkage, very few deviations from HW expectation (two of 572 pos-sible population/locus analyses) and thus no evidence for null alleles. There was a tendency for reduced polymor-phism towards the northern periphery. Keywords: Crotaphytus collaris, genetic variation, microsatellites, peripheral populations, population structure55411 polymorphic microsatellite loci in collared lizards (C. Collaris)   555Microsatellite loci were amplified using locus-specific conditions optimized for buffer, annealing temperature, and amplification cycles (Table 1). Fragments were am-plified with fluorescently labelled forward primers and visualized using a BaseStation DNA Fragment Ana-lyzer (MJ Research). Polymorphism was assessed using genomic DNA isolated from 512 collared lizards sam-pled at 52 sites across the species range (mean = 8.13 animals/population). All 11 loci reported here were polymorphic (six to 20 alleles per locus) and amplified reliably, although there was variability in their perfor-mance. Loci Orig6, Orig25 and Enri3 exhibited a ten-dency to form poly-A tails. Fortunately, this is remedied by adding a 30 minute extension of 72°C at the end of the PCR run. Loci Orig7 and N5 stuttered, but in each case the true band is much greater in amplitude than false bands. Population analyses with the gda computer program (Lewis & Zaykin 1996), revealed a range of av-erage heterozygosity values (0.143–0.530) across all 52 populations. Furthermore, no linkage disequilibrium was evident between any of the loci, despite the fact that Loci Orig24 and Orig25 are only separated by 138 base pairs. Bonferroni analyses (Rice 1989) showed only two populations, of 572 possible population/locus combi-nations, deviated significantly from Hardy–Weinberg expectations, thus giving little evidence for null alleles (Chakraborty et al. 1992). Workers interested in using these loci should be aware of potential geographical trends in polymor-phism in some of the loci. For example, although all loci were variable across the species range, nine (all but Orig25 and N5) exhibited lower levels of heterozygosity towards the northern periphery of the range. However, correlation analyses between levels of heterozygosity and latitude showed this trend was significant (5% level) for only six loci (Orig6, Orig11, Orig21, Orig24, Orig26, and Enri21), while only three remained significant af-ter Bonferroni analyses (Orig11, Orig24, and Orig26). Table 1. Temp (PCR annealing temperature), Buffers (PCR buffer; see below), Notes (locus-specific information; see below), n (number of individuals surveyed for variability); HO and HE (observed and expected heterozygosity values, respectively, aver-aged across all populations)                                                                                                                  Temp                 # alleles          Notes Locus      Primer Sequence (bp)                                         Motif         (°C)    Buffer   (size range)      (1–4)        n             HO           HE           GenBank # Orig6  For: AGGACACAAACATTCTTATC (20)  CA9  46  C  7 (138–150)  1  441  0.265  0.348  AY567818  Rev: TCTGAGTATTCCTTGCTT (18)  perfect Orig7  For: AGGTTGTGGTCTGTAGCA (18)  CA24  55  B  16 (199–229)  2  208  0.222  0.270  AY567819  Rev: GGATCTGTCCCAATAATG (18)  imperfect Orig11  For: CACTATAAGATGTAGCACTTGC (22)  CA8  56  D  7 (169–182)   256  0.091  0.162  AY567820  Rev: GGTAAGCACCAGATTGAGC (19)  perfect Orig21  For: GGGGTTGGAGCAAAGAG (17)  CA11  TD  C  17 (126–160)  3  190  0.160  0.223  AY567821  Rev: AAGCCCCGGAAGAAAAG (17)  perfect  (62–50) Orig24  For: AGTTGAACTCGATGCTCT (18)  GACA10  52  D  16 (144–204)  4  276  0.323  0.400  AY567822  Rev: ATTGAACCCATGGTAAAG (18)  imperfect Orig25  For: AGCCTTTACTGTGAGACCCA (20)  ATT10  51  D  12 (109–154)  1,4  313  0.354  0.417  AY567822  Rev: TCATGAAATGAAGCAAAATTAATAATA (27)  perfect Orig26  For: TATACATTCTTGAGTTCCGC (20)  CA8  54  J  20 (99–139)   329  0.294  0.324  AY567823  Rev: CAATGAGGGATATAAGGTGG (20)  perfect Enr3  For: CCTCAGCAGAAGCACCAGC (19)  CAG6  60  D  6 (101–116)  1  311  0.175  0.209  AY567824  Rev: TATTGAGCAGGACAGGGAAG (20)  perfect Enr21  For: AGGAAGGCTCAAAGGTTAC (19)  CCT6  60  D  6 (99–114)   453  0.378  0.350  AY567825  Rev: ATTTCACACAGGAGGAGGAGG (21)  perfect Enr48  For: TTTGTTCTTATTTTACTTGCGT (22)  CA13  50  A  11 (107–127)   394  0.412  0.530  AY567826  Rev: AGGTATTGTGCTGTCTGAGG (20)  perfect N5  For: CTGCCATATCATGAAGGGTG (20)  AT16  56  J  17 (166–198)  2  106  0.070  0.143  AY567827  Rev: AATCAGCACACTGGGAAAG (19)  perfect Buffers:  A − 200 mm Tris (pH 8.4), 250 mm KCl, 15 mm MgCl2  B − 200 mm Tris (pH 8.4), 250 mm KCl, 25 mm MgCl2  C − 200 mm Tris (pH 8.4), 500 mm KCl, 15 mm MgCl2  D − 200 mm Tris (pH 8.4), 500 mm KCl, 25 mm MgCl2 J  − 200 mm Tris (pH 9.2), 250 mm KCl, 25 mm MgCl2 Notes:  1 = Poly A (add 30 minute, 72°C  extension)  2 = Stutters, but readable since one peak much higher  3 = TD refers to touchdown PCR  4 = Physically linkage between loci 25 and 25 (no evidence of linkage disequilibrium)556  hutchison et al. in MoleCular eCology Notes  4 (2004)Thus, these three loci may prove less useful than others as measures of genetic variability in peripherally located populations. AcknowledgmentsThis work was funded by a National Science Foundation grant to Alan R. Templeton (DEB-9610219), an NSF Research Op-portunity Award to DWH (#DEB-0108874–002), and Howard Hughes Medical Institute Predoctoral Fellowships to JLS and JAB. We also wish to thank the Missouri Departments of Con-servation and Natural Resources. ReferencesBaird T. A., Acree M. A., Sloan C. L. (1996) Age and gender-related differences in the social behavior and mating suc-cess of free-living collared lizards, Crotaphytus collaris. Co-peia 1996: 2, 336– 347. Brisson J. A., Strasburg J. L., Templeton A. R. (2003) Impact of fire management on the ecology of collared lizard (Cro-taphytus collaris) populations living on the Ozark Plateau. Animal Conservation, 6, 247–254. Bruford M. W., Hanotte O., Brookfield J. F. Y., Burke T. (1992) Single-locus and multilocus DNA fingerprinting. In: Molec-ular Genetic Analyses of Populations: a Practical Approach (ed. Hoelzel AR), pp. 225–266. IRL Press, Oxford. Campbell J. H., McCoy J. K. (2002) Mitochondrial DNA analy-sis of gene flow among six populations of collared lizards (Crotaphytus collaris) in west central Texas. Texas Journal of Science, 54, 151–162. Chakraborty R., De Andrade M., Daiger S. P., Budowle R. (1992) Apparent heterozygosity deficiencies observed in DNA typing data and their implications in forensic appli-cations. Annals of Human Genetics, 56, 45–57. Hoelzel A. R., Green A. (1992) Analysis of population-level variation by sequencing PCR- amplified DNA. In: Molec-ular Genetic Analyses of Populations: a Practical Approach (ed. Hoelzel AR), pp. 159–187. IRL Press, Oxford. Hranitz J. M., Baird T. A. (2000) Effective population size and genetic structure of a population of collared lizards, Cro-taphytus collaris, central Oklahoma. Copeia 2000: 3, 786–791. Hutchison D. W. (1997) Population genetic consequences of the Holocene invasion of the Ozarks and Flint Hills by the eastern collared lizard (Crotaphytus collaris collaris) with subsequent habitat fragmentation. PhD Thesis, Washing-ton University in St. Louis. Hutchison D. W. (2003) Testing the central/peripheral model: Analyses of microsatellite variability in the eastern col-lared lizard (Crotaphytus collaris collaris). American Midland Naturalist, 149, 148–162. Lewis P. O., Zaykin D. (1996) Genetic Data Analysis, v, 1.0 (d6) for Windows 95/NT. Available at: http://lewis.eeb.uconn.edu/lewishome   McGuire J. A. (1996) Phylogenetic Systematics of Crotaphytid Liz-ards (Reptilia: Iguania: Crotaphytidae). Bulletin of the Carne-gie Museum of Natural History, Number. 32. Carnegie In-stitute, Pittsburgh, USA. Rice W. R. (1989) Analyzing tables of statistical tests. Evolution, 43, 223–225. Sambrook J., Fritsch E., Maniatis T. (1989) Molecular Cloning. A Laboratory Manual, 2nd ed. Cold Spring Harbor Labora-tory, New York. Templeton A. R., Robertson R. J., Brisson J., Strasburg J. (2001) Disrupting evolutionary processes: The effect of habitat fragmentation on collared lizards in the Missouri Ozarks. Proceedings of the National Academy of Sciences of the USA, 98, 5426–5432. Crotaphytus collaris, Stegall Mountain, Missouri (Alan Templeton & National Park Service)

https://digitalcommons.unl.edu/cgi/viewcontent.cgi?article=1072&amp;context=bioscifacpub

Isolation and characterization of 11 polymorphic microsatellite loci in collared lizards (\u3ci\u3eCrotaphytus collaris\u3c/i\u3e)

Abstract

Similar works

Full text

Available Versions

UNL | Libraries

DigitalCommons@University of Nebraska