Diaz, Jason, PhD

English

La Salle University Digital Commons

La Salle UniversityLa Salle University Digital CommonsExplorer Café Explorer Connection4-3-2019What Does My DNA Have to Say About MyIdentity?Jason Diaz PhDLa Salle University, diaz@lasalle.eduFollow this and additional works at: https://digitalcommons.lasalle.edu/explorercafeThis Presentation is brought to you for free and open access by the Explorer Connection at La Salle University Digital Commons. It has been acceptedfor inclusion in Explorer Café by an authorized administrator of La Salle University Digital Commons. For more information, please contactcareyc@lasalle.edu.Recommended CitationDiaz, Jason PhD, "What Does My DNA Have to Say About My Identity?" (2019). Explorer Café. 81.https://digitalcommons.lasalle.edu/explorercafe/81How does DNA Ancestry analysis work?AGTCACTGATACATCATGATCTAGDNA stores genetic information. It is written with four chemical “letters” – A T C G1   AGTCACTGAAACATCATGATCTAG2   AGTCACTGAAACATCATGATCTAG3   AGTCACTGATACATCATGATCTAG4   AGTCACTGATACATCATGATCTAG5   AGTCACTGATACATCATGATCTAG6   AGTCACTGAAACATCATGATCTAG7   AGTCACTGATACATCATGATCTAG8   AGTCACTGATACATCATGATCTAG9   AGTCACTGAAACATCATGATCTAG10 AGTCACTGATACATCATGATCTAG11   AGTCACTGATACATCATGATCTAG12   AGTCACTGATACATCATGATCTAG13   AGTCACTGAAACATCATGATCTAG14   AGTCACTGATACATCATGATCTAG15   AGTCACTGATACATCATGATCTAG16   AGTCACTGATACATCATGATCTAG17   AGTCACTGAAACATCATGATCTAG18   AGTCACTGATACATCATGATCTAG19 AGTCACTGATACATCATGATCTAG20   AGTCACTGAAACATCATGATCTAGSouth AsiaWest AfricaNow you take the test and we ask…do you have an A or a Tat this position? Gene XReference PopulationsCombine this with thousands of similar analyses…IndividualsAncestry.com48% Italy/Greece39% Ireland7% European Jewish1% Iberian Peninsula5% Other Regions23andMe11% Italian29.5% British and Irish1.5% French and German17.7% Northwestern Europe28.6% Southern European0.2 % North African One person –two different results!How should we think about our genetic heritage?Elizabeth Warren: American Indian?Native American Tribal Membership• Rules vary from tribe to tribe• Most require documentation of familial connection to the tribe• Many also require documented affiliation with the tribe• No tribe allows DNA Ancestry testing as evidence• Some tribes use a blood quantummeasurementCan you name any other ethnic communities that try to maintain genetic/blood “purity”?How would you define eligibility for membership in your ethnic community? Would you require evidence of familial connection?Blood ties? How would this be measured?What about adoptions and other “non-biological” inclusions? Is he black?Slavery erased much of the history of the enslaved people forcibly brought to America.Descendents of these enslaved people deserve to know their history.How should we incorporate our genetic history into our sense of identity?And now…a little perspective.What percentage of DNA is the same between these two movie stars?99.5% IdenticalGenetics, Anthropology, and Archeology Support a History of Migration Out of AfricaSome Facts to Keep in Mind• The Human Genome is ~3 Billion letters long• There are ~21,000 protein-coding genes • These genes make up ~2% of the whole genome• Even if 1,000 genes governed the physical features we see (and judge) every day, that would account for…• …0.1% of your genomeMy Thoughts…• Communities are social constructs• Communities are often built on biological realities• No single fact will give you a ticket into or out of a community• Community membership is ultimately a conversation between membersYour DNA ancestry is……at best……a conversation starter.

What Does My DNA Have to Say About My Identity?

https://digitalcommons.lasalle.edu/cgi/viewcontent.cgi?article=1081&context=explorercafe

What Does My DNA Have to Say About My Identity?

Abstract

Similar works

Full text

Available Versions

La Salle University Digital Commons