Goossens, H

Ieven, M

Niesters, H G

Quint, W

Ursi, D

van Bever, H

English

PCR fingerprinting was used to characterize clinical isolates of Mycoplasma pneumoniae. Among 24 strains tested, two types were distinguished. Nineteen strains belonged to type 1, whereas only 5 strains belonged to type 2. The majority of strains isolated since 1991 in Belgium belong to type 1. No variations in fingerprinting patterns were observed within each group, confirming the highly conserved nature of the M. pneumoniae genome.</p

ARTS repository - University of Groningen

   University of GroningenTyping of Mycoplasma pneumoniae by PCR-mediated DNA fingerprintingUrsi, D; Ieven, M; van Bever, H; Quint, W; Niesters, H G; Goossens, HPublished in:Journal of Clinical MicrobiologyIMPORTANT NOTE: You are advised to consult the publisher's version (publisher's PDF) if you wish to cite fromit. Please check the document version below.Document VersionPublisher's PDF, also known as Version of recordPublication date:1994Link to publication in University of Groningen/UMCG research databaseCitation for published version (APA):Ursi, D., Ieven, M., van Bever, H., Quint, W., Niesters, H. G., & Goossens, H. (1994). Typing ofMycoplasma pneumoniae by PCR-mediated DNA fingerprinting. Journal of Clinical Microbiology, 32(11),2873-5.CopyrightOther than for strictly personal use, it is not permitted to download or to forward/distribute the text or part of it without the consent of theauthor(s) and/or copyright holder(s), unless the work is under an open content license (like Creative Commons).The publication may also be distributed here under the terms of Article 25fa of the Dutch Copyright Act, indicated by the “Taverne” license.More information can be found on the University of Groningen website: https://www.rug.nl/library/open-access/self-archiving-pure/taverne-amendment.Take-down policyIf you believe that this document breaches copyright please contact us providing details, and we will remove access to the work immediatelyand investigate your claim.Downloaded from the University of Groningen/UMCG research database (Pure): http://www.rug.nl/research/portal. For technical reasons thenumber of authors shown on this cover page is limited to 10 maximum.Download date: 07-06-2022JOURNAL OF CLINICAL MICROBIOLOGY, Nov. 1994, p. 2873-2875 Vol. 32, No. 110095-1137/94/$04.00+0Copyright C) 1994, American Society for MicrobiologyTyping of Mycoplasma pneumoniae by PCR-MediatedDNA FingerprintingD. URSI,l* M. IEVEN,1 H. VAN BEVER,2 W. QUINT,3 H. G. M. NIESTERS,4 AND H. GOOSSENS1Departments of Microbiology' and Pediatrics,2 University Hospital, Antwerp, Belgium, and Diagnostic Center SSDZ,Delft,3 and Department of Virology, Academic Hospital Dijkzigt, Rotterdam,' The NetherlandsReceived 6 June 1994/Returned for modification 1 July 1994/Accepted 24 August 1994PCR fingerprinting was used to characterize clinical isolates of Mycoplasma pneumoniae. Among 24 strainstested, two types were distinguished. Nineteen strains belonged to type 1, whereas only 5 strains belonged totype 2. The majority of strains isolated since 1991 in Belgium belong to type 1. No variations in fingerprintingpatterns were observed within each group, confirming the highly conserved nature of the M. pneumoniae genome.Mycoplasma pneumoniae is an important respiratory tractpathogen. It is a leading cause of atypical pneumonia and otherrespiratory infections such as tracheobronchitis, bronchiolitis,croup, and less severe upper respiratory tract infections (8).The incidence rate varies greatly according to age and ishighest among primary school children. Epidemics take placeat intervals of 4 to 7 years (5). M. pneumoniae infections spreadslowly in the family setting, with a median case-to-case intervalof 23 days (4).A 170-kDa protein, P1, has been identified as a majorcytadhesin and virulence factor of M. pneumoniae (2). Thisprotein and the gene coding for it have been extensivelystudied. On the basis of hybridization patterns with subclonesof the P1 gene as probes in Southern blot analysis of genomicDNA (12), clinical isolates of M. pneumoniae can be classifiedinto two types. Sequence analysis of the P1 gene revealedsequence divergence between isolates belonging to the twodifferent types (10). This classification into two types wasconfirmed by restriction enzyme fingerprinting of genomicDNA and two-dimensional gel electrophoresis of total proteins(11). We report here on the use of a DNA amplificationfingerprinting technique (16) for typing a collection of 24isolates of M. pneumoniae.The M. pneumoniae strains analyzed in this study are listedin Table 1. Fifteen M. pneumoniae strains were isolated fromclinical samples in Antwerp, Belgium, in the course of a studyof respiratory tract infections in children during two winterperiods (from 1 October 1991 to 31 March 1992 and from 1October 1992 to 31 March 1993) (6). In this study, nasopha-ryngeal aspirates of pediatric patients were analyzed for thepresence of M. pneumoniae and respiratory viruses. The pres-ence of M. pneumoniae was detected by culture and by a PCRthat amplifies part of the P1 gene (15). The fifteen strains wereisolated from 15 outpatients epidemiologically not related toeach other. Besides the strains isolated in Belgium, nine otherstrains were analyzed: three strains isolated in the UnitedKingdom between 1983 and 1986 (M 15/83, M 414/86, and M510/86) and three strains isolated in The Netherlands between1970 and 1987 (P 635, P 71, and P 84). Finally, three M.pneumoniae reference strains were included in the study (FH,MAC, and PI 1428).For cultivation, a 0.2-ml aliquot of nasopharyngeal aspirate* Corresponding author. Mailing address: Department of Microbi-ology, University Hospital, Antwerp, Wilrijkstraat 10, 2650 Edegem,Belgium. Phone: 32-3-829-11-11. Fax: 32-3-825-42-81.was inoculated into 2 ml of SP4 broth (14) without thalliumacetate and supplemented with amphotericin B (0.5 mg/ml)and polymyxin B (500 U/ml). Three serial 20-fold dilutions ofthis primary broth were made in SP4 broth. The four brothswere incubated aerobically at 37°C and observed for colorchange over a period of 6 weeks. When color change wasnoticed, a 0.1-ml aliquot of the broth was subcultured on anSP4 solid medium (made by adding 8 g of agar per liter). TheSP4 agar was examined weekly for the appearance of typical M.pneumoniae colonies, which were then subcultured in freshSP4 broth for subsequent DNA extraction.Lyophilized M. pneumoniae strains that were sent to ourlaboratory were cultivated accordingly.For DNA extraction, 200 ,ul of culture was centrifuged at13,000 x g for 40 min at room temperature. Pellets wereresuspended in 150 RI of buffer containing 50 mM glucose, 25mM Tris HCl (pH 8), and 10 mM EDTA and lysed afteraddition of 12.5 RI (1 mg/ml) of proteinase K and 12.5 RI of10% (wt/vol) sodium dodecyl sulfate. Incubation took place at50°C for 30 min. DNA was isolated by subsequent phenol andphenol-chloroform-isoamyl alcohol (25:24:1) extractions fol-lowed by ethanol precipitation (9). DNA concentrations wereestimated by gel electrophoresis through 1% agarose gels in0.09 M Tris borate-0.002 M EDTA, staining with ethidiumbromide, and comparison with samples containing a knownamount of DNA (9).For PCR fingerprinting, several primers were tested. A listof the primers used is presented in Table 2. For amplification,the reaction mixtures consisted of 10 mM Tris HCl (pH 9), 50mM KCl, 2.5 mM MgCl2, 0.1% Triton X-100, and 0.2 mMdeoxynucleoside triphosphates. One unit of Taq DNA poly-merase (Shaero-Q, Leiden, The Netherlands), 50 pmol ofprimers, and about 10 ng of DNA were used in a final reactionvolume of 100 pI. The amplification time and temperatureprofiles that were used for primers HLW 74, HLW 85, 1254, D14216, and D 8635 were as described previously (1, 7). Withprimer OJPU4, the first four cycles consisted of 5 min ofdenaturation at 94°C, 5 min of hybridization at 36°C, and 5 minof elongation at 72°C. For the 30 cycles that followed, thedenaturation and hybridization times were reduced to 1 min,whereas the elongation time was reduced to 2 min. The finalelongation step was 10 min. Amplifications were carried out ina Biomed model 60 thermocycler or a Techne model PHC-2thermocycler. The amplification products were size fractionatedon a 1% agarose gel containing 0.09 M Tris borate and 0.002 MEDTA and visualized by staining with ethidium bromide (9).In a first series of experiments, all primers listed in Table 22873 on February 15, 2016 by University of Groningenhttp://jcm.asm.org/Downloaded from J. CLIN. MICROBIOL.TABLE 1. M. pneumoniae strains used in the studyStrain Source Yr and source of Clinical picture TypebisolationFH (NCTC 10119) NCTC 1959; not specified Pneumonia 2M 15/83 NCTC 1983; sputum Pneumonia 1M414/86 NCTC 1986; sputum Pneumonia 1M510/86 NCTC 1986; sputum Pneumonia 1P635 RIVM 1970's; throat swab Pneumonia 2P71 RIVM 1987; BALC Pneumonia 1P84 RIVM 1973; not specified Pneumonia 2M2117350 UZA 1992; NPAd Acute bronchitis 1M2107084 UZA 1992; throat swab Acute bronchitis 1Erythema multiformaM2117245 UZA 1992; NPA URTI" 1M2107079 UZA 1992; sputum Acute lobar pneumonia 1M2107374 UZA 1992; NPA Acute lobar pneumonia 1M2117235 UZA 1992; throat swab Acute lobar pneumonia 1M2117430 UZA 1992; NPA Acute bronchitis 1M3057031 UZA 1993; NPA Acute bronchitis 1M3037439 UZA 1993; NPA Acute bronchopneumonia 121C86 UZA 1992; NPA Acute bronchitis 121K11 UZA 1992; NPA Acute bronchopneumonia 221K33 UZA 1992; NPA Acute bronchopneumonia 121G93 UZA 1992; NPA Acute bronchopneumonia 121I105 UZA 1992; sputum Acute bronchopneumonia 1ExanthemaDEV UZA 1991; NPA Acute bronchopneumonia 1Erythema multiformaPI1428 (ATCC 29085) ATCC 1964; throat swab Pneumonia 1MAC (ATCC 15492) ATCC 1944; lung tissue Not specified 2a Abbreviations: NCTC, National Collection of Type Cultures, Central Public Health Laboratory, London, United Kingdom; ATCC, American Type CultureCollection, Rockville, Md.; RIVM, Rijksinstituut voor Volksgezondheid en Milieuhygiene, Bilthoven, The Netherlands; UZA, Universitair Ziekenhuis Antwerpen,Edegem, Belgium.b Typing results were obtained with PCR fingerprinting as described in this study.BAL, bronchoalveolar lavage.d NPA, nasopharyngeal aspirate.URTI, upper respiratory tract infection.were used to amplify DNA from 15 M pneumoniae strainschosen randomly from the collection of strains listed in Table1. One primer (D 8635) produced the same pattern for allstrains examined. With the other primers, two patterns couldbe observed, the difference being most pronounced withprimers OJPU4 and 1254.In a second series of experiments, primer OJPU4 was usedto amplify DNA from the 24 M pneumoniae strains of thecollection. Primer 1254 was used to confirm the results ob-tained with OJPU4.Our collection of strains could be divided into two types onthe basis of their PCR fingerprinting patterns with OJPU4 and1254. The majority of strains (19 of 24) belonged to type 1.Only five strains were classified as type 2 because they showeda different pattern with both primers: strains MAC, FH, P 84,P 635, and 21K11. Fingerprinting patterns of representatives ofthe two groups with primers 1254 and OJPU4 are shown in Fig.1. The results obtained with the PCR fingerprinting werereproducible from one run to another, except for differences inband intensities that were therefore not taken into consideration.Moreover, the method is fairly rapid, because amplification andseparation of amplification products can be performed in 1 day.Our results confirm the existence of only two types amongclinical isolates ofM pneumoniae strains, as was demonstratedby other typing methods (10-12). Within each type, no varia-tions in DNA or protein fingerprinting profiles were observed(11). These and our findings indicate thatM pneumoniae as aspecies has preserved overall genetic homology. Diversity of aspecies reflects evolutionary genetic divergence arising fromrandom, nonlethal mutations that accumulate over time. Mpneumoniae has one of the smallest genomes of known self-replicating organisms, about 809 kb (17). Selective pressureTABLE 2. DNA primers used for PCR-mediated genetic typing of M. pneumoniae isolatesPrimer Primer sequence Primer type ReferencenumberHLW 74 5' ACGTATCTGC 3' Arbitrary 7HLW 85 5' ACAACTG-CTC 3' Arbitrary 71254 5' CCGCAGCCAA 3' Arbitrary 1D14216 5' NNNAACAGCTATGACCATG 3' Arbitrary 1D8635 5' GAGCGGCCAAAGGGAGCAGAC 3' Arbitrary 1OJPU4 5' GGCCATGACCGCGAACTATCCG 3' P1 gene sequence (nt 1191-1212)a This studya Nucleotides (nt) are numbered according to reference 13.2874 NOTES on February 15, 2016 by University of Groningenhttp://jcm.asm.org/Downloaded from NOTES 2875AFIG. 1. PCR-mediated DNA typing of M. pneumoniae strains.Banding patterns obtained with M. pneumoniae strains with primer1254 (A) and with primer OJPU4 (B) are shown. Lanes: 1 to 3, M.pneumoniae type 1 strains; 4 to 6, M. pneumoniae type 2 strains; M,molecular weight marker (pBR328-BglI and Hinfl fragments) (Boehr-inger Mannheim, Mannheim, Germany).may be too high in M. pneumoniae because of the small size ofits genome, preventing diversity of the species. Clearly, the M.pneumoniae population structure is highly clonal. Of course, itcannot be excluded that by performing PCR fingerprintingwith other arbitrary primers or by performing sequence anal-ysis of unknown regions of the genome, additional differencesbetween isolates belonging to the same type will be found.In the study by Su et al. (12), 29 M. pneumoniae strains wereincluded, collected from different geographic areas (California,North and South Carolina, Texas, Washington, and France)and at different times (from 1944 to 1988). On the basis ofgenotyping, they found only 4 strains that belonged to type 1out of 29 tested, whereas the great majority of their strainsbelonged to type 2 (25 of 29). This is in sharp contrast to ourfindings, since we found only 5 strains belonging to type 2 outof 24 tested. Our classification of type 2 strains is based on thetype found for the reference strains FH and MAC that wereclassified by Su et al. (12) as type 2. The reference strain PI1428 that we used in this study was classified by Chandler et al.(3) in the same group as strain M 129, which is classified as atype 1 strain in the study of Su et al. (12), whereas Chandler et al.also classified strains FH and MAC as type 2 in their genotypicstudy. Therefore, the majority of strains that were isolated inBelgium during the last 2 years belong to Su et al.'s (12) type 1classification.Apparently, two types of M. pneumoniae strains are encoun-tered worldwide. Interestingly, the prevalence of each typeseems to be related by time and geography. In the 1970s and1980s, the majority of strains isolated in the United States andFrance were type 2 strains. However, the three strains isolatedin the 1980s in the United Kingdom were type 1 strains. Themajority of strains that have been found since 1991 in Belgiumare type 1 strains. Maybe this switch in prevalent type can beexplained by the immune status of the population against onetype or another.Another interesting point is whether the type of strain can beassociated with the clinical picture of the patient. In this study,we could not find a relationship between the type of strain andthe severity of the disease (Table 1). The majority of patientshad pneumonia or bronchitis. Only one patient had an upperrespiratory tract infection. This strain could not be distin-guished from the others on the basis of the fingerprinting pattern.We conclude that PCR fingerprinting is a rapid and reliablemethod for typing M. pneumoniae isolates. There is an excel-lent correlation with results obtained with other moleculartyping methods. M pneumoniae isolates can be divided intotwo types. The method could not distinguish isolates withineach group, confirming the highly conserved nature of the Mpneumoniae genome and clonality of the population structure.We thank J. Tully for providing us with very helpful information forthe cultivation of M. pneumoniae and sending us some M. pneumoniaestrains, R. Leach from the NCTC and A. Angulo from the RIVM forsending us their M. pneumoniae isolates, P. Vandamme for criticalreading of the manuscript and helpful comments, and Edwin Fries fortechnical assistance.REFERENCES1. Akopyanz, N., N. Bukanov, T. Westblom, S. Kresovich, and D.Bery. 1992. DNA diversity among clinical isolates of Helicobacterpylon detected by PCR based RAPD fingerprinting. Nucleic AcidsRes. 20:5137-5142.2. Baseman, J. B., R. M. Cole, D. C. Krause, and D. K. Leith. 1982.Molecular basis for cytadsorption of Mycoplasma pneumoniae. J.Bacteriol. 151:1514-1522.3. Chandler, D. K. F., S. Razin, E. B. Stephens, R Harasawa, andM. F. Barile. 1982. Genomic and phenotypic analyses of Myco-plasma pneumoniae strains. Infect. Immun. 38:604-609.4. Foy, H. M., J. T. Grayston, and G. Kenny. 1966. Epidemiology ofMycoplasma pneumoniae infection in families. JAMA 197:859-866.5. Foy, H. M., G. E. Kenny, M. K. Cooney, and I. D. Allan. 1979.Long-term epidemiology of infections with Mycoplasma pneu-moniae. J. Infect. Dis. 139:681-687.6. leven, M., D. Ursi, H. G. M. Niesters, W. Quint, H. Van Bever, andH. Goossens. Unpublished data.7. Mazurier, S. I., and K. Wernars. 1992. Typing of Listeria strains byrandom amplification of polymorphic DNA. Res. Microbiol. 143:499-505.8. Niitu, Y. 1983. Mycoplasma pneumoniae respiratory diseases: clin-ical features-children. Yale J. Biol. Med. 56:493-503.9. Sambrook, J., E. F. Fritsch, and T. Maniatis. 1989. Molecularcloning: a laboratory manual, 2nd ed., p. E.3-E.4. Cold SpringHarbor Laboratory, Cold Spring Harbor, N.Y.10. Su, C. J., A. Chavoya, S. F. Dallo, and J. B. Baseman. 1990.Sequence divergency of the cytadhesin gene of Mycoplasma pneu-moniae. Infect. Immun. 58:2669-2674.11. Su, C. J., S. F. Dallo, H. Alderman, and J. B. Baseman. 1991.Distinctions in DNA and protein profiles among clinical isolates ofM. pneumoniae. J. Gen. Microbiol. 137:2727-2732.12. Su, C. J., S. F. Dallo, and J. B. Baseman. 1990. Moleculardistinctions among clinical isolates of Mycoplasma pneumoniae. J.Clin. Microbiol. 28:1538-1540.13. Su, C. J., V. V. Tryon, and J. B. Baseman. 1987. Cloning andsequence analysis of cytadhesin P1 gene from Mycoplasma pneu-moniae. Infect. Immun. 55:3023-3029.14. Tully, J. G., R F. Whitcomb, H. F. Clark, and D. L. Williamson.1977. Pathogenic mycoplasmas. Cultivation and vertebrate patho-genicity of a new spiroplasma. Science 195:892-894.15. Ursi, J. P., D. Ursi, M. leven, and S. R Pattyn. 1992. Utility of aninternal control for the polymerase chain reaction. Application todetection of Mycoplasma pneumoniae in clinical specimens. ActaPathol. Microbiol. Immunol. Scand. 100:635-639.16. Welsh, J., and M. McClelland. 1990. Fingerprinting genomes usingPCR with arbitrary primers. Nucleic Acids Res. 18:7213-7218.17. Wenzl, R, E. Pirkl, and R Herrmann. 1992. Construction of anEcoRI restriction map of Mycoplasma pneumoniae and localiza-tion of selected genes. J. Bacteriol. 174:7289-7296.VOL. 32, 1994 on February 15, 2016 by University of Groningenhttp://jcm.asm.org/Downloaded from 

Typing of Mycoplasma pneumoniae by PCR-mediated DNA fingerprinting

https://pure.rug.nl/ws/files/28586028/J._Clin._Microbiol._1994_Ursi_2873_5.pdf

Typing of Mycoplasma pneumoniae by PCR-mediated DNA fingerprinting

Abstract

Similar works

Full text

Available Versions

ARTS repository - University of Groningen