Buys, CHCM

English

ARTS repository - University of Groningen

   University of GroningenTelomeres, telomerase, and cancerBuys, CHCMPublished in:New England Journal of MedicineIMPORTANT NOTE: You are advised to consult the publisher's version (publisher's PDF) if you wish to cite fromit. Please check the document version below.Document VersionPublisher's PDF, also known as Version of recordPublication date:2000Link to publication in University of Groningen/UMCG research databaseCitation for published version (APA):Buys, CHCM. (2000). Telomeres, telomerase, and cancer. New England Journal of Medicine, 342(17),1282-1283.CopyrightOther than for strictly personal use, it is not permitted to download or to forward/distribute the text or part of it without the consent of theauthor(s) and/or copyright holder(s), unless the work is under an open content license (like Creative Commons).The publication may also be distributed here under the terms of Article 25fa of the Dutch Copyright Act, indicated by the “Taverne” license.More information can be found on the University of Groningen website: https://www.rug.nl/library/open-access/self-archiving-pure/taverne-amendment.Take-down policyIf you believe that this document breaches copyright please contact us providing details, and we will remove access to the work immediatelyand investigate your claim.Downloaded from the University of Groningen/UMCG research database (Pure): http://www.rug.nl/research/portal. For technical reasons thenumber of authors shown on this cover page is limited to 10 maximum.Download date: 07-06-2022 1282 · Apr i l  27,  2000 The New England Journal  of  Medicine Clinical Implicationsof Basic Research T ELOMERES , T ELOMERASE ,  AND  C ANCER HAT accounts for the ability of cancer cells toproliferate in a manner that is out of control,whereas normal cells die after 40 to 60 cycles of rep-lication? One mechanism that leads to the death ofa normal cell is erosion of the structure that caps theends of chromosomes — the telomere (from theGreek  telos,  meaning end, and  meros,  a component)— each time a cell divides. The clinical relevance oftelomeres is that a cancer cell, unlike a normal cell,can repair eroded telomeres. The existence of thisrepair mechanism suggests a novel target for cancertreatment.Before any cell can divide, it must first replicatethe double-stranded DNA in its chromosomes. Butthe cell has a problem replicating the DNA at thetelomeres, where there are over 1000 short base se-quences, TTAGGG, repeated over and over again anda variety of DNA-binding proteins. In a normal cell,the replication machinery cannot copy the last fewbases of the telomeres on one of the strands of DNAin the chromosome. As a result, the telomeres short-en with each round of DNA replication.The telomere, a kind of molecular cap, protects theends of the chromosome against degradation andprevents ligation of the ends of DNA by DNA-repairenzymes. These functions are crucial to the cell. Whenrepeated during many cell cycles, the wearing awayof the telomere with each cell division eventually ab-rogates its protective function. As a result, the chro-mosomes become unstable, fused, or lost. Cells withsuch defects not only are unable to divide, but alsomay not survive; they may die as a result of apopto-sis. Attrition of the telomere thereby limits the lifespan of many kinds of cells.There are, however, two distinctive kinds of cells— germ cells and early embryonic cells — that mustovercome this problem, because the body cannot af-ford to lose them. They solve the problem of thetruncated telomere by means of a complex of pro-teins and RNA called telomerase. The RNA compo-nent of this complex contains a template sequenceon which the TTAGGG repeats at the ends of DNAcan be synthesized.Unlike germ cells and early embryonic cells, mostsomatic cells switch off the activity of telomerase af-ter birth. By contrast, many kinds of cancer cells —perhaps as many as 90 percent of them — reactivatetelomerase. Turning on this complex, which rewindsW the clock on run-down telomeres, contributes to thegrowth of the malignant clone. Several recent stud-ies have explored the possibility of inhibiting telo-merase as a way of arresting the growth of tumorcells. 1-3 Part of the telomerase complex is an enzymecalled telomerase reverse transcriptase. Using theRNA template in the telomerase complex, this en-zyme catalyzes the synthesis of the TTAGGG se-quences at the end of the telomere (Fig. 1). Re-searchers have been able to introduce into culturedcancer cells a mutant gene that causes the cell toproduce an inactive telomerase reverse transcriptase,which competes with the active form in the com-plex. This interference with the active enzyme causesshortening of telomeres, induces many of the chro-mosomal changes associated with the aging of nor-mal cells, and arrests the growth of the cells, which ul-timately undergo apoptosis. These effects were shownto depend on the length of the telomeres in the can-cer cells — the shorter the telomere, the more pro-found the effect of the mutant gene. Even more in-teresting is the finding that human cancer cellscarrying the mutant gene lose their ability to formtumors in immunologically deficient mice.In other experiments, human cancer cells weretreated in vitro with specific 2'- O -methylated RNAand peptide nucleic acid oligomers, compounds thatbind to and block the activity of the telomerase com-plex. Both agents caused considerable inhibition oftelomerase, shortening of telomeres, and with repeat-ed treatment, apoptosis of all the cells in the culture.These results are doubtless interesting and suggestnew possibilities for the treatment of cancer. Wemust, however, remember several points. First, the ex-periments were conducted in cell lines, and the effi-cient uptake of inhibitors was ensured by means thatare unavailable for in vivo treatment. Second, the in-hibitors worked best in cultured tumor cells whentelomeres were shortest, but little is known about thelength of telomeres in primary human tumors. A re-cent study found that malignant-lymphoma speci-mens obtained from patients at the time of diagnosishad shorter telomeres than benign lymphoid tissue. Inlymphoma specimens obtained during relapses, how-ever, shortened, unchanged, and elongated telomereswere observed. 4  Third, up to 20 percent of humantumors do not have telomerase activity and may useother mechanisms to preserve their telomeres. Eventhough the therapeutic potential of telomerase inhib-itors may be limited by these considerations, furtherinvestigation of this approach is certainly worthwhile.Attrition of telomeres may also be a contributingfactor in chronic diseases with high rates of cell turn-over in specific tissues, such as bone marrow in thecase of myeloproliferative diseases or hepatocytes inthe case of cirrhosis. In such diseases, the reactivationof telomerase may offer a new treatment. This ideaThe New England Journal of Medicine Downloaded from nejm.org at University of Groningen on June 8, 2021. For personal use only. No other uses without permission.  Copyright © 2000 Massachusetts Medical Society. All rights reserved.  CLINICAL IMPLICATIONS OF BASIC RESEARCH Volume 342 Number 17 · 1283 is supported by a recent report that the introductionof the gene encoding the RNA component of thetelomerase complex into the liver in telomerase-defi-cient mice with experimentally induced chronic liverinjury prevented cirrhosis. 5  It is clear, however, thatany plan to use telomerase gene therapy in humansshould take into account the potential risk of tumorinduction. C HARLES  H.C.M. B UYS , P H .D. University of Groningen9713 AW Groningen, the Netherlands REFERENCES 1. Hahn WC, Stewart SA, Brooks MW, et al. Inhibition of telomerase lim-its the growth of human cancer cells. Nat Med 1999;5:1164-70. 2. Zhang X, Mar V, Zhou W, Harrington L, Robinson MO. Telomere shortening and apoptosis in telomerase-inhibited human tumor cells. Genes Dev 1999;13:2388-99. 3. Herbert B-S, Pitts AE, Baker SI, et al. Inhibition of human telomerase in immortal human cells leads to progressive telomere shortening and cell death. Proc Natl Acad Sci U S A 1999;96:14276-81. 4. Remes K, Norrback KF, Rosenquist R, Mehle C, Lindh J, Roos G. Tel-omere length and telomerase activity in malignant lymphomas at diagnosis and relapse. Br J Cancer 2000;82:601-7. 5. Rudolph KL, Chang S, Millard M, Schreiber-Agus N, DePinho RA. In-hibition of experimental liver cirrhosis in mice by telomerase gene delivery. Science 2000;287:1253-8. Figure 1.  Function of Telomerase. Telomerase repairs the eroding ends, or telomeres, of chromosomes by adding TTAGGG se-quences. At the telomere of a chromosome, the short base sequence TTAGGG occurs re-peatedly in the 5'-to-3' strand of DNA (the upper DNA strand). In most types of cells, thechromosome-replication machinery cannot complete the replication of the very end of the3'-to-5' strand (the lower DNA strand), resulting in a shortening of the telomere with eachround of DNA replication that precedes cell division. Germ cells, early embryonic cells, andcancer cells have a special enzyme, telomerase, that adds bases to the 3' end of the DNAstrand that serves as the replication template. Telomerase is a complex consisting of an RNAcomponent and several protein components, including a reverse transcriptase. The RNA com-ponent contains a template sequence that is complementary to the TTAGGG telomeric re-peat sequence. Using this template, telomerase reverse transcriptase catalyzes the additionof nucleotides to the 3' ends of telomeres. Telomerase thus moves along the DNA, elongat-ing the telomere.TTAGGGTTAGGGTTAGGGTTAGGGTTAG 3’TTAGGGTTAGGGTTAGGGTTAG 3’TTAGGGTTAGGGTTAGGGTTAG 3’TTAGGGTTAGGGT TAG 3’CAAUCCCAAUCCAAUCCCAAUCCAAUCCCAAUCAATCCCAAAATCCCAAAATCCCAAAATCCCAAElongation5’3’Translocation5’3’Repeatedelongation5’3’Telomerasereverse transcriptaseTelomeraseRNA ©2000, Massachusetts Medical Society.The New England Journal of Medicine Downloaded from nejm.org at University of Groningen on June 8, 2021. For personal use only. No other uses without permission.  Copyright © 2000 Massachusetts Medical Society. All rights reserved. 

Telomeres, telomerase, and cancer

https://pure.rug.nl/ws/files/172697177/nejm200004273421710.pdf

Telomeres, telomerase, and cancer

Abstract

Similar works

Full text

Available Versions

ARTS repository - University of Groningen