Banana is one of the world's most important trade commodities. However, infection of banana pathogenic fungi (Fusarium oxysporum race 4) is one of the major causes of decreasing production in Indonesia. Genetic engineering has become an alternative way to control this problem by isolating genes that involved in plant defense mechanism against pathogens. Two of the important genes are API5 and ChiI1, each gene encodes apoptosisinhibitory protein and chitinase enzymes. The purpose of this study was to study the expression of API5 and ChiI1 genes as candidate pathogenic resistance genes. The amplified fragments were then cloned, sequenced, and confirmed with in silico studies. Based on sequence analysis, it is showed that partial API5 gene has putative transactivationdomain and ChiI1 has 9 chitinase family GH19 protein motifs. Data obtained from this study will contribute in banana genetic improvement

Dwivany, Fenny M.

Esyanti, Rizkita Rahmi

Pratiwi, Aksarani 'Sa

Zaskia, Herafi

Scientific Journals of Bogor Agricultural University

ble at ScienceDirectHAYATI Journal of Biosciences 23 (2016) 196e199Contents lists availaHOSTED BYHAYATI Journal of Biosciencesjournal homepage: http : / /www.journals .e lsevier .com/hayat i - journal-of-biosciencesOriginal research articleExpression Study of Banana Pathogenic Resistance GenesFenny M. Dwivany,1,2,3* Rizkita Rahmi Esyanti,1,3 Aksarani 'Sa Pratiwi,1,2 Heraﬁ Zaskia1,21 School of Life Sciences and Technology, Institut Teknologi Bandung, Indonesia.2 ForMIND Institute, Indonesia.3 Bioscience and Biotechnology Research Center, Institut Teknologi Bandung, Bandung, Indonesia.a r t i c l e i n f oArticle history:Received 16 October 2015Accepted 25 June 2016Available online 16 March 2017KEYWORDS:apoptosis inhibitor 5 (API5),Arabidopsis thaliana,chitinase (ChiI1),Musa acuminata,pathogen resistance* Corresponding author.E-mail address: fenny@sith.itb.ac.id (F.M. DwivanyPeer review under responsibility of Institut Pertahttp://dx.doi.org/10.1016/j.hjb.2016.06.0071978-3019/Copyright © 2017 Institut Pertanian Bogocreativecommons.org/licenses/by-nc-nd/4.0/).a b s t r a c tBanana is one of the world's most important trade commodities. However, infection of banana patho-genic fungi (Fusarium oxysporum race 4) is one of the major causes of decreasing production in Indonesia.Genetic engineering has become an alternative way to control this problem by isolating genes thatinvolved in plant defense mechanism against pathogens. Two of the important genes are API5 and ChiI1,each gene encodes apoptosis inhibitory protein and chitinase enzymes. The purpose of this study was tostudy the expression of API5 and ChiI1 genes as candidate pathogenic resistance genes. The ampliﬁedfragments were then cloned, sequenced, and conﬁrmed with in silico studies. Based on sequenceanalysis, it is showed that partial API5 gene has putative transactivation domain and ChiI1 has 9 chitinasefamily GH19 protein motifs. Data obtained from this study will contribute in banana geneticimprovement.Copyright © 2017 Institut Pertanian Bogor. Production and hosting by Elsevier B.V. This is an open accessarticle under the CC BY-NC-ND license (http://creativecommons.org/licenses/by-nc-nd/4.0/).1. IntroductionIndonesia as one of the mega biodiversity country has beenknown as a fruit producer for local or global consumption.Indonesia is one of the main banana producer countries in theworld. However, the export of fresh fruit was only about 10% of totallocal production (Purwadaria 2006). This is because of severalproblems that occur at preharvest and postharvest stages. One ofthe preharvest problems is susceptibility to pathogen attack, suchas bacterial, viral, and fungal infections. One of major issues inbanana disease is bananawilt caused by pathogenic fungi, Fusariumoxysporum f.sp. cubense (Foc) (Dimyati et al. 2001). As soilbornefungi, the spore of Fusarium stays on the soil and is hard to eradicate(Walduck and Daly 2006). Therefore, this disease has led to a lossharvest of 20.000 tons in Lampung province in 1993e1994 (Dimyatiet al. 2001).Foc as soilborne fungi infects plants through the roots and thencolonizes the vascular tissues in the rhizome and pseudostem andﬁnally causing plant wilt that can cause plant death (Beckman 1987,1990). Wilting symptoms on infected plants usually occur in thesame time with necrosis and rotting in the root, rhizome, and the).nian Bogor.r. Production and hosting by Elsvessels of pseudostem (Perez-vicente 2004). Banana diseasetreatment so far still uses conventional methods such as conven-tional breeding, pesticide usage, optimization of bananas plantingtechnical process, and utilization of biocontrol agents. However,most of the commercial banana possessing triploids (AAA) aresterile, thus hybridization is less effective (Heslop-Harrison 2011).Therefore, genetic engineering has become the most promisingmethod to be an alternative solution to solve these diseases (Gurrand Rushton 2005). Transgenic methods in developing crops suchas tobacco, potato, and cucumber have chosen to express pathogenresistance-related genes (Reimann-Philipp and Beachy 1993).Previous studies have shown that transgene could result in Focresistance in banana plants. For instance, antiapoptosis genes thatare isolated from animal cells can be used as resistance gene to Focinfection in tobacco plants, tomatoes, and bananas (Li et al. 2010;Paul et al. 2011). As an alternative of antiapoptosis genes from an-imal cells, we found that plant antiapoptosis inhibitor 5 (API5)genes were also available at the genome database of Arabidopsisthaliana. In addition, class I chitinase gene (ChiI1) from Musa ABgroup (FJ858155.2) was also available at GenBank. This gene en-codes chitinase, which is an enzyme that has a role in degradingchitin component on fungi cell wall. Therefore, this research wasfocused to study A. thaliana API5 and local banana (pisang ambonlumut, Musa acuminata AAA group) ChiI1 gene expressions beforeisolation of full-length genes. The results are expected to be areference for conducting overexpression of both genes to produceevier B.V. This is an open access article under the CC BY-NC-ND license (http://Banana pathogenic resistance genes 197transgenic banana plants that are resistant to Foc attack. Theresistance of bananas to Fusarium pathogens is expected to improvethe quality and quantity of banana production in Indonesia. Thiscan provide beneﬁts for banana farmers in Indonesia, increasingexport and support agroindustry by reducing production lossescaused by pathogen attack.2. Materials and Methods2.1. Gene expression studyGene expression study was done by reverse transcription po-lymerase chain reaction to amplify ChiI1 from pisang ambon lumut(M. acuminata AAA group) leaf complementary DNA (cDNA) usingthe method of Handayani and Dwivany (2014) and Dwivany et al.(2015). Primers were designed based on sequences of class I chiti-nase gene (ChiI1) Musa AB group (FJ858155.2). The primers were50(GACTGCTAAGGAGGATGAAG)3' as forward primer and 50(GGCCATGTACTAGTTCAGC)30 as reverse primer. Meanwhile, tostudy expression of API5, root cDNA of A. thaliana (12 leaves stageplants) was used as template. Primers were designed based onsequences of A. thaliana API5 (NM_128955.4). The primers were50(AATTTCATCAGAGATAAGGTGA)3' as forward primer and50(ACTTGTTATTACCAGTGACC)3' as reverse primer.2.2. Gene characterizationThe cDNA fragments were then sequenced and analyzed throughin silico studies. Web sites and software used are Softberry© (Soft-berry, Inc., http://www.softberry.com), analysis of protein localiza-tion at sites CELLO (http://www.cello.life.nctu.edu.tw/cgi/main.cgi),analysis of local alignment (BLAST) from the GenBank Web site(http://www.ncbi.nlm.nih.gov), and multiple sequencealignment with ClustalW (http://www.srs.ebi.ac.uk). Gene annota-tions were also conducted with CLC Genomics Workbench v3.6.5©software (QIAGEN Bioinformatics).3. Results3.1. Gene expression studyThe ~1178 bp API5 was ampliﬁed from root tissue cDNA(Figures 1A and 1C). This result shows that API5 was expressed inthe root of A. thaliana plant. Meanwhile, ~1053 bp fragment wasFigure 1. PCR result of API5 gene ampliﬁcation using touchdown (A) PCR method and (B) Cgene ampliﬁcation. PCR, polymerase gene reaction.ampliﬁed using ChiI1 gene-speciﬁc primers from leaf cDNA(Figures 1B and 1D). This result showed that the genes wereexpressed in banana leaf tissue.3.2. Gene characterizationMotifs from each sequence were characterized with in silicostudies. Figure 2A shows that putative API5 amino acid sequenceshave the same motifs with API5 from another species such as Oryzasativa and Homo sapiens. In the ﬁgure, one represent as LXXLLmotif, two represent as transactivation domain, whereas threerepresent as nuclear localization sequence. From the alignment,putative API5 shares partial amino acid sequences characterized astransactivation domain.As for the chitinase, it has been found that several motifs arebased on themultiple sequence alignment result (Figure 2B). Motifs1, 2, 3, 5,12, and 13 are chitinase proteinmotifs found only in plants,whereas others may be found in another species, such as arthro-pods, purple bacteria, actinobacteria, and nematodes (UdayaPrakash et al. 2010).4. DiscussionTo identify putative genes, both cDNA fragments were clonedand sequenced, and the sequencing results were then analyzedwith BLAST. The sequences were aligned to both nucleotide andprotein database in GenBank. Alignment results showed that pu-tative genes of API5 share high homology with API5 gene andprotein from A. thaliana. Based on nucleotide alignment (BLASTn),putative API5 gene shares 90% homology with A. thaliana apoptosisinhibitory protein 5 (API5) (NM_128955.4). In addition, putativeAPI5 gene sequence was also compared with protein database inGenBank using BLASTx alignment. Predicted amino acid sequenceof putative API5 gene shares 96% homology to API5 protein isolatedfrom A. thaliana. Because of this sequence similarity, putative API5that has been successfully isolated is considered as one of the API5gene (NP_565777.1). API5 genes were also compared for its aminoacid motifs and protein domain using characteristics comparedfrom other known API5 gene family, speciﬁcally from Oryza sativaand Homo sapiens (Li et al. 2011). From Figure 2A, putative API5,both OsAPI5 and HsAPI5 have conservative motifs, such as LxxLLmotif, transactivation domain, nuclear localization sequence, and ahiI1 gene from cDNA pisang ambon lumut. (C) and (D) show primers position for eachFigure 2. (A) Multiple sequence alignment between putative AtAPI5 and another API5 protein from Oryza sativa (OsAPI5) and Homo sapiens (HsAPI5). (B) GH19 chitinase familyprotein motifs found on reference gene sequence (Musa AB group,Musa paradisiaca) and isolated gene fragment from pisang ambon lumut. These motifs are (1) [RS]QAGGALCP[NG]GLCCS [QKE][FY]GWCG[SN]; (2) [CK][GQ]PGCQSQC[GTS][GP]; (3) [IL]IS[RS]S[LQ]F [DN][QD]ML[KL]HRND[AG]ACP[AG]; (4) FYTY[DN][AG][FL][IV][AT]AAK [SA]FP[GA]F[GA][TN]TG;(5) E[IV]AAF[LF][GA]QTSHETTGGW[AP][TS]APD GP[YF][AS]WGYCF; (6) DA[ITV]CK[RK][ES][LAI]A[AT]F[LF]A[NQH][VF] [SA][HQ]E[TS]GG[LH]x[YA][VI]VExN; (7) [FHY]-G-R-G-[AP]-x-Q-[IL]-[ST]-[FHYW]-[HN]-[FY]-NY; (8) Y[YF]GRGPIQ[LI][ST][WY]N[YF]NYG[AP][AC] GRA; (9) NNPDLVA[TN]D[AP][VT][IV][SA][FW]KTA[LI]WFW; (10) MT[PA]Q [SP]PKPSCHDVITG[RQ]W; (11) DSAAGR[LVG][PA]G[YF]GV[IT][TI]NIINGG [LI]EC; (12) G[RK]GQDSRV; and (13) [DN]RIGF[YF][KQ]RYCD[IL][LF]GV [GS][YP]G[DN]NLDCYNQR[PS]F.F.M. Dwivany, et al198leucine zipper (Plevin et al. 2005; Li et al. 2011). HsAPI5 also pre-dicted to have such motifs, but it was found that there are differ-ences from its amino acid residues. This comparison of motifsshows that putative gene that has been isolated from cDNA ofA. thalianaWT is suitable as one of the members of API5 genebecause it has transactivation domain, a characteristic of anti-apoptosis gene.The 1053 bp ChiI1 cDNA sequence was also compared withBLASTn method. BLASTn results showed that the isolated basesequence has a sequence similarity with class I chitinase genes inMusa AB group (94%) and partial sequence of M. acuminata endo-chitinase (98%). Chitinase is found in a wide range of organisms:bacteria, viruses, animals, and higher plants. Chitinase class I has achitin-binding domain that is rich with amino acid cysteine at the Nterminus and a catalytic region at C terminus, and all these areconnected through the linker that has a short peptide of 10e20amino acid residues. Chitinase class II only has a catalytic regionhomologous to chitinase class I. Chitinase class IV has homologywith class I. Chitinase class III and V show no similarities with classI, II, and IV but has obvious sequence similarity with chitinase se-quences belonging to bacteria and fungi (Funkhouser and Aronson,2007; Seidl 2008). Henrissat and Bairoch (1993) have proposed aclassiﬁcation system for glycosyl hydrolase enzymes. Based on thisclassiﬁcation, the enzyme chitinase classes I, II, and IV were clas-siﬁed as family 19, whereas chitinases class III, IIIb, and V weregrouped into family 18.Predicted amino acid sequence of the isolated gene fragmentwas performed using BioEdit software version 7.1.3.0 (IbisBiosciences, http://www.mbio.ncsu.edu/BioEdit/bioedit.html) andamino acid sequence prediction program on http://www.softberry.com site. This amino acid sequence then aligned with the aminoacid sequence of Musa AB group that was used as a reference indesigning primers for gene ampliﬁcation and Musa paradisiaca.Both of them have full-length chitinase gene sequences (http://ncbi.nlm.nih.gov). This alignment was done to ﬁnd and compareconserved protein motif of GH19 chitinase family on the isolatedgene fragment and sequence references (Figure 2). Based on theproteinmotif analysis, there are 13 proteinmotifs of GH19 chitinasefamily present in the reference gene sequence,Musa AB group, andM. paradisiacal, whereas there are only nine family GH19 chitinasemotifs found in the isolated chitinase gene fragment from pisangambon lumut. The six GH19 chitinase motifs are typical of plantchitinase, whereas three other motifs are highly conserved throughGH19 family chitinase. Thesemotifs support that the gene fragmentisolated from pisang ambon lumut is a strong candidate of class Ichitinase gene family GH19.Based on the expression study, API5 gene was expressed inA. thaliana root and has putative transactivation domain. On theother hand, ChiI1 gene was expressed in pisang ambon lumut leaf(M. acuminata AAA group) and has chitinase family GH19 proteinmotifs. Further gene isolation and characterization need to be doneto obtain full-length resistance genes and their protein functions.Therefore, it can be used as a promising candidate of resistancegenes to produce pathogen-resistant plants. For further research,overexpression of these genes need to be done to determine if itconfers to resistance to Foc.AcknowledgementThis research was funded by Asahi Glass Foundation throughAsahi Glass Research grant program in 2012 for Fenny Dwivany.Conﬂicts of InterestThe authors declare no conﬂict of interest.ReferencesBeckman CH. 1987. The Nature of Wilt Disease of Plants. St. Paul, MN: The AmericanPhytopathological Society.Beckman CH. 1990. Host responses to the pathogen. In: Ploetz RC (Ed.). FusariumWilt of the Banana. St. Paul, MN: The American Phytopatological Society.pp. 107e14.Dimyati A, Djatnika, Hermanto C, Nasir N, Hasyim A. 2001. Current research ac-tivities on banana diseases and pests in Indonesia. Adv Banan Plantain R D AsiaPac 10:110e22.Dwivany F, Esyanti RR, Robertlee J, Paramaputra IC, Permatadewi RK, Tambun DH,Tambuni DH, Pratiwi AS, Zaskia H. 2015. Environment effect on fruit ripeningrelated gene to develop a new post harvest technology. AIP Conf Proc 1589:285e7. http://dx.doi.org/10.1063/1.4868801., 285 (2014).Funkhouser JD, Aronson NN. 2007. Chitinase family GH18: evolutionary insightsfrom the genomic history of a diverse protein family. BMC Evol Biol 7:96.Gurr SJ, Rushton PJ. 2005. Engineering plants with increased disease resistance:what are we going to express? Trends Biotechnol 23(6):275e82.Handayani RU, Dwivany FM. 2014. Analysis of MaACS2, a stress-inducible ACCsynthase gene in musa acuminata AAA group cultivar Pisang Ambon. J MathFundam Sci 46(2):194e203.Henrissat B, Bairoch A. 1993. New families in the classiﬁcation of glycosyl hydrolasesbased on amino acid sequence similarities. Biochem J 293(Pt 3(January)):781e8.Banana pathogenic resistance genes 199Heslop-Harrison JS. 2011. Genomics, banana breeding and superdomestication. ActaHortic 897:55e62.Li W, Kabbage M, Dickman MB. 2010. Transgenic expression of an insect inhibitor ofapoptosis gene, SfIAP, confers abiotic and biotic stress tolerance and delaystomato fruit ripening. Physiol Mol Plant Pathol 74(5e6):363e75.Li X, Gao X, Wei Y, Deng L, Ouyang Y, Chen G, Li X, Zhang Q, Wu C. 2011. RiceAPOPTOSIS INHIBITOR5 coupled with two DEAD-box adenosine 50-triphos-phate-dependent RNA helicases regulates tapetum degeneration. Plant Cell23(4):1416e34.Paul JY, Becker DK, Dickman MB, Harding RM, Khanna HK, Dale JL. 2011. Apoptosis-related genes confer resistance to Fusarium wilt in transgenic “Lady Finger”bananas. Plant Biotechnol J 9(9):1141e8.Perez-vicente L. 2004. Fusarium Wilt (Panama Disease) of bananas: an updatingreview of the current knowledge on the disease and its causal agent. Race:1e15.Plevin MJ, Mills MM, Ikura M. 2005. The LxxLL motif: a multifunctional bindingsequence in transcriptional regulation. Trends Biochem Sci 30(2):66e9.Purwadaria HK. 2006. Issues and Solutions of Fresh Fruit Export in Indonesia.pp. 24e33.Reimann-Philipp U, Beachy RN. 1993. Plant resistance to virus diseases throughgenetic engineering: can a similar approach control plant-parasitic nematodes?J Nematol 25(4):541.Seidl V. 2008. Chitinases of ﬁlamentous fungi: a large group of diverse proteins withmultiple physiological functions. Fungal Biology Reviews 22(1):36e42.Udaya Prakash NA, Jayanthi M, Sabarinathan R, Kangueane P, Mathew L, Sekar K.2010. Evolution, homology conservation, and identiﬁcation of unique sequencesignatures in GH19 family chitinases. J Mol Evol 70(5):466e78.Walduck G, Daly A. 2006. PROJECT: project ofﬁcers: banana tropical race 4 panamadisease management. Agnote 151(November):7e11.

Expression Study of Banana Pathogenic Resistance Genes

HAYATI Journal of Biosciences

ble at ScienceDirectHAYATI Journal of Biosciences 23 (2016) 196e199Contents lists availaHOSTED BYHAYATI Journal of Biosciencesjournal homepage: http : / /www.journals .e lsevier .com/hayat i - journal-of-biosciencesOriginal research articleExpression Study of Banana Pathogenic Resistance GenesFenny M. Dwivany,1,2,3* Rizkita Rahmi Esyanti,1,3 Aksarani 'Sa Pratiwi,1,2 Herafi Zaskia1,21 School of Life Sciences and Technology, Institut Teknologi Bandung, Indonesia.2 ForMIND Institute, Indonesia.3 Bioscience and Biotechnology Research Center, Institut Teknologi Bandung, Bandung, Indonesia.a r t i c l e i n f oArticle history:Received 16 October 2015Accepted 25 June 2016Available online 16 March 2017KEYWORDS:apoptosis inhibitor 5 (API5),Arabidopsis thaliana,chitinase (ChiI1),Musa acuminata,pathogen resistance* Corresponding author.E-mail address: fenny@sith.itb.ac.id (F.M. DwivanyPeer review under responsibility of Institut Pertahttp://dx.doi.org/10.1016/j.hjb.2016.06.0071978-3019/Copyright © 2017 Institut Pertanian Bogocreativecommons.org/licenses/by-nc-nd/4.0/).a b s t r a c tBanana is one of the world's most important trade commodities. However, infection of banana patho-genic fungi (Fusarium oxysporum race 4) is one of the major causes of decreasing production in Indonesia.Genetic engineering has become an alternative way to control this problem by isolating genes thatinvolved in plant defense mechanism against pathogens. Two of the important genes are API5 and ChiI1,each gene encodes apoptosis inhibitory protein and chitinase enzymes. The purpose of this study was tostudy the expression of API5 and ChiI1 genes as candidate pathogenic resistance genes. The amplifiedfragments were then cloned, sequenced, and confirmed with in silico studies. Based on sequenceanalysis, it is showed that partial API5 gene has putative transactivation domain and ChiI1 has 9 chitinasefamily GH19 protein motifs. Data obtained from this study will contribute in banana geneticimprovement.Copyright © 2017 Institut Pertanian Bogor. Production and hosting by Elsevier B.V. This is an open accessarticle under the CC BY-NC-ND license (http://creativecommons.org/licenses/by-nc-nd/4.0/).1. IntroductionIndonesia as one of the mega biodiversity country has beenknown as a fruit producer for local or global consumption.Indonesia is one of the main banana producer countries in theworld. However, the export of fresh fruit was only about 10% of totallocal production (Purwadaria 2006). This is because of severalproblems that occur at preharvest and postharvest stages. One ofthe preharvest problems is susceptibility to pathogen attack, suchas bacterial, viral, and fungal infections. One of major issues inbanana disease is bananawilt caused by pathogenic fungi, Fusariumoxysporum f.sp. cubense (Foc) (Dimyati et al. 2001). As soilbornefungi, the spore of Fusarium stays on the soil and is hard to eradicate(Walduck and Daly 2006). Therefore, this disease has led to a lossharvest of 20.000 tons in Lampung province in 1993e1994 (Dimyatiet al. 2001).Foc as soilborne fungi infects plants through the roots and thencolonizes the vascular tissues in the rhizome and pseudostem andfinally causing plant wilt that can cause plant death (Beckman 1987,1990). Wilting symptoms on infected plants usually occur in thesame time with necrosis and rotting in the root, rhizome, and the).nian Bogor.r. Production and hosting by Elsvessels of pseudostem (Perez-vicente 2004). Banana diseasetreatment so far still uses conventional methods such as conven-tional breeding, pesticide usage, optimization of bananas plantingtechnical process, and utilization of biocontrol agents. However,most of the commercial banana possessing triploids (AAA) aresterile, thus hybridization is less effective (Heslop-Harrison 2011).Therefore, genetic engineering has become the most promisingmethod to be an alternative solution to solve these diseases (Gurrand Rushton 2005). Transgenic methods in developing crops suchas tobacco, potato, and cucumber have chosen to express pathogenresistance-related genes (Reimann-Philipp and Beachy 1993).Previous studies have shown that transgene could result in Focresistance in banana plants. For instance, antiapoptosis genes thatare isolated from animal cells can be used as resistance gene to Focinfection in tobacco plants, tomatoes, and bananas (Li et al. 2010;Paul et al. 2011). As an alternative of antiapoptosis genes from an-imal cells, we found that plant antiapoptosis inhibitor 5 (API5)genes were also available at the genome database of Arabidopsisthaliana. In addition, class I chitinase gene (ChiI1) from Musa ABgroup (FJ858155.2) was also available at GenBank. This gene en-codes chitinase, which is an enzyme that has a role in degradingchitin component on fungi cell wall. Therefore, this research wasfocused to study A. thaliana API5 and local banana (pisang ambonlumut, Musa acuminata AAA group) ChiI1 gene expressions beforeisolation of full-length genes. The results are expected to be areference for conducting overexpression of both genes to produceevier B.V. This is an open access article under the CC BY-NC-ND license (http://Banana pathogenic resistance genes 197transgenic banana plants that are resistant to Foc attack. Theresistance of bananas to Fusarium pathogens is expected to improvethe quality and quantity of banana production in Indonesia. Thiscan provide benefits for banana farmers in Indonesia, increasingexport and support agroindustry by reducing production lossescaused by pathogen attack.2. Materials and Methods2.1. Gene expression studyGene expression study was done by reverse transcription po-lymerase chain reaction to amplify ChiI1 from pisang ambon lumut(M. acuminata AAA group) leaf complementary DNA (cDNA) usingthe method of Handayani and Dwivany (2014) and Dwivany et al.(2015). Primers were designed based on sequences of class I chiti-nase gene (ChiI1) Musa AB group (FJ858155.2). The primers were50(GACTGCTAAGGAGGATGAAG)3' as forward primer and 50(GGCCATGTACTAGTTCAGC)30 as reverse primer. Meanwhile, tostudy expression of API5, root cDNA of A. thaliana (12 leaves stageplants) was used as template. Primers were designed based onsequences of A. thaliana API5 (NM_128955.4). The primers were50(AATTTCATCAGAGATAAGGTGA)3' as forward primer and50(ACTTGTTATTACCAGTGACC)3' as reverse primer.2.2. Gene characterizationThe cDNA fragments were then sequenced and analyzed throughin silico studies. Web sites and software used are Softberry© (Soft-berry, Inc., http://www.softberry.com), analysis of protein localiza-tion at sites CELLO (http://www.cello.life.nctu.edu.tw/cgi/main.cgi),analysis of local alignment (BLAST) from the GenBank Web site(http://www.ncbi.nlm.nih.gov), and multiple sequencealignment with ClustalW (http://www.srs.ebi.ac.uk). Gene annota-tions were also conducted with CLC Genomics Workbench v3.6.5©software (QIAGEN Bioinformatics).3. Results3.1. Gene expression studyThe ~1178 bp API5 was amplified from root tissue cDNA(Figures 1A and 1C). This result shows that API5 was expressed inthe root of A. thaliana plant. Meanwhile, ~1053 bp fragment wasFigure 1. PCR result of API5 gene amplification using touchdown (A) PCR method and (B) Cgene amplification. PCR, polymerase gene reaction.amplified using ChiI1 gene-specific primers from leaf cDNA(Figures 1B and 1D). This result showed that the genes wereexpressed in banana leaf tissue.3.2. Gene characterizationMotifs from each sequence were characterized with in silicostudies. Figure 2A shows that putative API5 amino acid sequenceshave the same motifs with API5 from another species such as Oryzasativa and Homo sapiens. In the figure, one represent as LXXLLmotif, two represent as transactivation domain, whereas threerepresent as nuclear localization sequence. From the alignment,putative API5 shares partial amino acid sequences characterized astransactivation domain.As for the chitinase, it has been found that several motifs arebased on themultiple sequence alignment result (Figure 2B). Motifs1, 2, 3, 5,12, and 13 are chitinase proteinmotifs found only in plants,whereas others may be found in another species, such as arthro-pods, purple bacteria, actinobacteria, and nematodes (UdayaPrakash et al. 2010).4. DiscussionTo identify putative genes, both cDNA fragments were clonedand sequenced, and the sequencing results were then analyzedwith BLAST. The sequences were aligned to both nucleotide andprotein database in GenBank. Alignment results showed that pu-tative genes of API5 share high homology with API5 gene andprotein from A. thaliana. Based on nucleotide alignment (BLASTn),putative API5 gene shares 90% homology with A. thaliana apoptosisinhibitory protein 5 (API5) (NM_128955.4). In addition, putativeAPI5 gene sequence was also compared with protein database inGenBank using BLASTx alignment. Predicted amino acid sequenceof putative API5 gene shares 96% homology to API5 protein isolatedfrom A. thaliana. Because of this sequence similarity, putative API5that has been successfully isolated is considered as one of the API5gene (NP_565777.1). API5 genes were also compared for its aminoacid motifs and protein domain using characteristics comparedfrom other known API5 gene family, specifically from Oryza sativaand Homo sapiens (Li et al. 2011). From Figure 2A, putative API5,both OsAPI5 and HsAPI5 have conservative motifs, such as LxxLLmotif, transactivation domain, nuclear localization sequence, and ahiI1 gene from cDNA pisang ambon lumut. (C) and (D) show primers position for eachFigure 2. (A) Multiple sequence alignment between putative AtAPI5 and another API5 protein from Oryza sativa (OsAPI5) and Homo sapiens (HsAPI5). (B) GH19 chitinase familyprotein motifs found on reference gene sequence (Musa AB group,Musa paradisiaca) and isolated gene fragment from pisang ambon lumut. These motifs are (1) [RS]QAGGALCP[NG]GLCCS [QKE][FY]GWCG[SN]; (2) [CK][GQ]PGCQSQC[GTS][GP]; (3) [IL]IS[RS]S[LQ]F [DN][QD]ML[KL]HRND[AG]ACP[AG]; (4) FYTY[DN][AG][FL][IV][AT]AAK [SA]FP[GA]F[GA][TN]TG;(5) E[IV]AAF[LF][GA]QTSHETTGGW[AP][TS]APD GP[YF][AS]WGYCF; (6) DA[ITV]CK[RK][ES][LAI]A[AT]F[LF]A[NQH][VF] [SA][HQ]E[TS]GG[LH]x[YA][VI]VExN; (7) [FHY]-G-R-G-[AP]-x-Q-[IL]-[ST]-[FHYW]-[HN]-[FY]-NY; (8) Y[YF]GRGPIQ[LI][ST][WY]N[YF]NYG[AP][AC] GRA; (9) NNPDLVA[TN]D[AP][VT][IV][SA][FW]KTA[LI]WFW; (10) MT[PA]Q [SP]PKPSCHDVITG[RQ]W; (11) DSAAGR[LVG][PA]G[YF]GV[IT][TI]NIINGG [LI]EC; (12) G[RK]GQDSRV; and (13) [DN]RIGF[YF][KQ]RYCD[IL][LF]GV [GS][YP]G[DN]NLDCYNQR[PS]F.F.M. Dwivany, et al198leucine zipper (Plevin et al. 2005; Li et al. 2011). HsAPI5 also pre-dicted to have such motifs, but it was found that there are differ-ences from its amino acid residues. This comparison of motifsshows that putative gene that has been isolated from cDNA ofA. thalianaWT is suitable as one of the members of API5 genebecause it has transactivation domain, a characteristic of anti-apoptosis gene.The 1053 bp ChiI1 cDNA sequence was also compared withBLASTn method. BLASTn results showed that the isolated basesequence has a sequence similarity with class I chitinase genes inMusa AB group (94%) and partial sequence of M. acuminata endo-chitinase (98%). Chitinase is found in a wide range of organisms:bacteria, viruses, animals, and higher plants. Chitinase class I has achitin-binding domain that is rich with amino acid cysteine at the Nterminus and a catalytic region at C terminus, and all these areconnected through the linker that has a short peptide of 10e20amino acid residues. Chitinase class II only has a catalytic regionhomologous to chitinase class I. Chitinase class IV has homologywith class I. Chitinase class III and V show no similarities with classI, II, and IV but has obvious sequence similarity with chitinase se-quences belonging to bacteria and fungi (Funkhouser and Aronson,2007; Seidl 2008). Henrissat and Bairoch (1993) have proposed aclassification system for glycosyl hydrolase enzymes. Based on thisclassification, the enzyme chitinase classes I, II, and IV were clas-sified as family 19, whereas chitinases class III, IIIb, and V weregrouped into family 18.Predicted amino acid sequence of the isolated gene fragmentwas performed using BioEdit software version 7.1.3.0 (IbisBiosciences, http://www.mbio.ncsu.edu/BioEdit/bioedit.html) andamino acid sequence prediction program on http://www.softberry.com site. This amino acid sequence then aligned with the aminoacid sequence of Musa AB group that was used as a reference indesigning primers for gene amplification and Musa paradisiaca.Both of them have full-length chitinase gene sequences (http://ncbi.nlm.nih.gov). This alignment was done to find and compareconserved protein motif of GH19 chitinase family on the isolatedgene fragment and sequence references (Figure 2). Based on theproteinmotif analysis, there are 13 proteinmotifs of GH19 chitinasefamily present in the reference gene sequence,Musa AB group, andM. paradisiacal, whereas there are only nine family GH19 chitinasemotifs found in the isolated chitinase gene fragment from pisangambon lumut. The six GH19 chitinase motifs are typical of plantchitinase, whereas three other motifs are highly conserved throughGH19 family chitinase. Thesemotifs support that the gene fragmentisolated from pisang ambon lumut is a strong candidate of class Ichitinase gene family GH19.Based on the expression study, API5 gene was expressed inA. thaliana root and has putative transactivation domain. On theother hand, ChiI1 gene was expressed in pisang ambon lumut leaf(M. acuminata AAA group) and has chitinase family GH19 proteinmotifs. Further gene isolation and characterization need to be doneto obtain full-length resistance genes and their protein functions.Therefore, it can be used as a promising candidate of resistancegenes to produce pathogen-resistant plants. For further research,overexpression of these genes need to be done to determine if itconfers to resistance to Foc.AcknowledgementThis research was funded by Asahi Glass Foundation throughAsahi Glass Research grant program in 2012 for Fenny Dwivany.Conflicts of InterestThe authors declare no conflict of interest.ReferencesBeckman CH. 1987. The Nature of Wilt Disease of Plants. St. Paul, MN: The AmericanPhytopathological Society.Beckman CH. 1990. Host responses to the pathogen. In: Ploetz RC (Ed.). FusariumWilt of the Banana. St. Paul, MN: The American Phytopatological Society.pp. 107e14.Dimyati A, Djatnika, Hermanto C, Nasir N, Hasyim A. 2001. Current research ac-tivities on banana diseases and pests in Indonesia. Adv Banan Plantain R D AsiaPac 10:110e22.Dwivany F, Esyanti RR, Robertlee J, Paramaputra IC, Permatadewi RK, Tambun DH,Tambuni DH, Pratiwi AS, Zaskia H. 2015. Environment effect on fruit ripeningrelated gene to develop a new post harvest technology. AIP Conf Proc 1589:285e7. http://dx.doi.org/10.1063/1.4868801., 285 (2014).Funkhouser JD, Aronson NN. 2007. Chitinase family GH18: evolutionary insightsfrom the genomic history of a diverse protein family. BMC Evol Biol 7:96.Gurr SJ, Rushton PJ. 2005. Engineering plants with increased disease resistance:what are we going to express? Trends Biotechnol 23(6):275e82.Handayani RU, Dwivany FM. 2014. Analysis of MaACS2, a stress-inducible ACCsynthase gene in musa acuminata AAA group cultivar Pisang Ambon. J MathFundam Sci 46(2):194e203.Henrissat B, Bairoch A. 1993. New families in the classification of glycosyl hydrolasesbased on amino acid sequence similarities. Biochem J 293(Pt 3(January)):781e8.Banana pathogenic resistance genes 199Heslop-Harrison JS. 2011. Genomics, banana breeding and superdomestication. ActaHortic 897:55e62.Li W, Kabbage M, Dickman MB. 2010. Transgenic expression of an insect inhibitor ofapoptosis gene, SfIAP, confers abiotic and biotic stress tolerance and delaystomato fruit ripening. Physiol Mol Plant Pathol 74(5e6):363e75.Li X, Gao X, Wei Y, Deng L, Ouyang Y, Chen G, Li X, Zhang Q, Wu C. 2011. RiceAPOPTOSIS INHIBITOR5 coupled with two DEAD-box adenosine 50-triphos-phate-dependent RNA helicases regulates tapetum degeneration. Plant Cell23(4):1416e34.Paul JY, Becker DK, Dickman MB, Harding RM, Khanna HK, Dale JL. 2011. Apoptosis-related genes confer resistance to Fusarium wilt in transgenic “Lady Finger”bananas. Plant Biotechnol J 9(9):1141e8.Perez-vicente L. 2004. Fusarium Wilt (Panama Disease) of bananas: an updatingreview of the current knowledge on the disease and its causal agent. Race:1e15.Plevin MJ, Mills MM, Ikura M. 2005. The LxxLL motif: a multifunctional bindingsequence in transcriptional regulation. Trends Biochem Sci 30(2):66e9.Purwadaria HK. 2006. Issues and Solutions of Fresh Fruit Export in Indonesia.pp. 24e33.Reimann-Philipp U, Beachy RN. 1993. Plant resistance to virus diseases throughgenetic engineering: can a similar approach control plant-parasitic nematodes?J Nematol 25(4):541.Seidl V. 2008. Chitinases of filamentous fungi: a large group of diverse proteins withmultiple physiological functions. Fungal Biology Reviews 22(1):36e42.Udaya Prakash NA, Jayanthi M, Sabarinathan R, Kangueane P, Mathew L, Sekar K.2010. Evolution, homology conservation, and identification of unique sequencesignatures in GH19 family chitinases. J Mol Evol 70(5):466e78.Walduck G, Daly A. 2006. PROJECT: project officers: banana tropical race 4 panamadisease management. Agnote 151(November):7e11.

English

http://journal.ipb.ac.id/index.php/hayati/article/download/20756/14231

Expression Study of Banana Pathogenic Resistance Genes

Abstract

Similar works

Full text

Available Versions

Scientific Journals of Bogor Agricultural University

HAYATI Journal of Biosciences