El objetivo de este estudio fue asignar por mapa ligamiento el gen Endotelina-1 (END1) al cromosoma 2 del pollo (GGA2). Los microsatélites MCW0314, MCW0245, ADL0164, MCW0264 y el diseño de cebadores fueron usados para la amplificación de secuencias específicas de END1. La técnica PCR-SSCP y el uso de geles denaturantes permitió la tipificación de los genotipos. Para la construcción del mapa se usaron los genotipos identificados en una población de 200 pollos Cobb500 utilizando el programa Mapmaker® version 3.0b. El resultado es un mapa del GGA2 donde END1 está ligado a los microsatélites reportados en un locus de un carácter cuantitativo (QTL) para susceptibilidad de los pollos de engorde a desarrollar el síndrome de hipertensión pulmonar

Moncaleano-Vega, Juana

English

Universidad del Tolima: Portal der Revistas

Revista Colombiana de Ciencia Animal, Vol. 9, No. 1, 2016 31Linkage mapping of the Endothelin-1 gene to chicken chromosome 2Mapa de ligamiento del gen Endotelina-1 en el cromosoma 2 del polloJuana Moncaleano-Vega, MSc1*; Susan Castro, MSc 2; Marcela Ríos, MSc2; Fernando Ariza, PhD2.ResumenEl objetivo de este estudio fue asignar por mapa ligamiento el gen Endotelina-1 (END1) al cromosoma 2 del pollo (GGA2). Los microsatélites MCW0314, MCW0245, ADL0164, MCW0264 y el diseño de cebadores fueron usados para la amplificación de secuencias específicas de END1. La técnica PCR-SSCP y el uso de geles denaturantes permitió la tipificación de los genotipos. Para la construcción del mapa se usaron los genotipos identificados en una población de 200 pollos Cobb500 utilizando el programa Mapmaker® version 3.0b.  El resultado es un mapa del GGA2 donde END1 está ligado a los microsatélites reportados en un locus de un carácter cuantitativo (QTL) para susceptibilidad de los pollos de engorde a desarrollar el síndrome de hipertensión pulmonar.Palabras claves: síndrome de hipertensión pulmonar, pollos de engorde, microsatélites.AbstractThe aim of this study was assigned by linkage map the Endothelin-1 gene (END1) to the Chicken chromosome 2 (GGA2). The microsatellites MCW0314, MCW0245, ADL0164, MCW0264 were used and primers for amplification of specific sequences END1 were designed. The PCR-SSCP technique, and the use of denaturing gels allowed the characterization of the genotype. The genotypes identified in 200 broilers Cobb500 and Mapmaker® version 3.0b program were used in the map construction. The result, a map in which END1 is linked to microsatellites that it was reported in quantitative trait loci (QTL) for susceptibility of broilers to develop pulmonary hypertension syndrome in the GGA2.Keywords: Pulmonary Hypertension Syndrome, broilers, microsatellites.1 Grupo de Investigación en Inmunobiología y Patogénesis. Departamento de Producción Pecuaria, Facultad de Medicina Veterinaria y Zootecnia, Universidad del Tolima, Ibagué, Colombia. 2Departamento de Producción Animal, Facultad de Medicina Veterinaria y de Zootecnia, Universidad Nacional de Colombia, Bogotá, Colombia.*Autor de correspondencia: E-mail: jsmoncaleanov@ut.edu.coIntroducciónPulmonary Hypertension Syndrome (PHS) affects approximately 25% of broilers production around the world (Hassanzadeh et al., 2014). Syndrome includes heart failure, ascites and develop pulmonary arterial hypertension by vasoconstriction and vascular remodeling of small pulmonary arteries (Buzala et al., 2015). Broilers breeders are more predisposed for intensive genetic selection of economically important production traits like feed efficiency and carcass quality (Kalmara et al., 2013; Hassanzadeh et al., 2014; Resnyk et al., 2015). PHS is considered polygenic resulting from the susceptibility genes and environmental factors combination (Binder, 2007; Wideman et al., 2013). Candidates genes selected to study the PHS are physiologically implicated in blood pressure regulation e.g. Endothelin-1 (EDN1) (Gomez et al., 2007; Flores, 2013). In broilers, EDN1 gene is found on chromosome two (GGA2; Gene ID: 420854) (Moncaleano-Vega et al., 2013). The detection of sequence changes in this candidate gene will lead the identification of polymorphisms and it is used in marker linkage analysis, characterization of economic importance loci and detection of mutation causing disease in domestic livestock species. The PCR coupled with SSCP (single strand conformation polymorphism) analysis and denaturing condition gels can be used to exclude defined mutation from large family groups (Ariza et al., 2001) or non- family groups (Inesta et al., 2005). The aim of this study was assignment by linkage mapping the END1 with quantitative trait loci (QTL) ´s microsatellites reported for PHS susceptibility broilers to GGA2.Materials and methodsDNA of 200 broilers Cobb500 line (DNA bank of Cytogenetic laboratory, Faculty of Veterinary Revista Colombiana de Ciencia Animal, Vol. 9, No. 1, 201632Medicine and Zootechnics, Universidad Nacional de Colombia, Bogotá, Colombia), oligonucleotide primers of END1 (intron 1th) were derived from sequences present in the Ensembl database (http://www.ensembl.org/Gallus_gallus/Gene/Summary?db=otherfeatures;g=420854;r=2:62883381-62888254;t=XM_418943.4), it was design with tool web free primer3 (http://biotools.umassmed.edu/bioapps/primer3_www.cgi) and used in the SSCP analysis. The microsatellites primers were taking from Rabie et al. (2005) and used denaturants gels to analysis (Table 1). Table 1. Sequence of primers for PCR amplification of 1 locus on GGA2Marker Longitude pb Primer forward 5’-3’ Primer reverse 5’-3’ Tm*MCW0314 278-84 GCCAGGCTACACCTCTTCTAG GTTGGTATGATGGTATGATGC 58.5°C*MCW0245 284-90 ATCTATGGCCACCTCAAACTG GATCTGTGCTGAACACAGCAG 61°C*ADL0164 150-200 TCCTCAGGCCTTTCAACATA GGTAGCATGAACAAAGCATC 58°C*MCW0264 208-63 AGACTGAGTCACACTCGTAAG CTTACTTTTCACGACAGAAGC 56°C**ET1 150 AGAGACAACATGAAAGTCACC TGCGGGATCATCAGAAGTAG 56°C*Rabie et al. (2005).**Primers were design with intron 1th sequences stored in the Ensembl database using primer3 web tool.Polymerase chain reaction were performed in a volume of 12.5 ul, using 25 ng of chicken genome DNA, 20 ng of each of the forward and reverse primers, 12.5 mM of each of dATP, dGTP, dTTP, dCTP and 0.3 U Taq polymerase. PCR amplifications were obtained using the following protocol: 95 °C for 3 min, then 30 s at 95°C, 60 s between 56 and 61°C, 90s at 72°C for 30 cycles, finally 72°C for 10 min. Products were assayed by electrophoresis in 6% Bis-acrylamide nondenaturing and denaturing. DNA fragments can be visualized silver straining method (Figura 1).   A     B  Figure 1.  (A) END1 Gel conditions for the SSCP technical were 5% of glycerol, 49:1 bis-acrylamide 6% concentration and 8 Watts during 15 h. Genotypes 12, 22, 13 and 11. (B) Gel condition denaturant for microsatellites, 29:1 bis-acrylamide 6% concentration and 65 – 75 Watts during 2.3 - 3.3 h.  Genotypes 11 and 12. Silver straining.Figure 2. The Endothelin-1 gene (END1) was linked to MCW0314, MCW0245, ADL164 and MCW0264 microsatellites located at the end of chromosome 2 (GGA2). The markers have been ordered and the number to left indicates their position in distance Kosambi cM. These possible locations of the loci whose order is supported by LOD score > 3.0 and θ < 0.5. The MAPMAKER® version 3.0b program was used to determine locus order and map linkage on GGA2 with a Lod score greater than 3.0 and recombination frequency less 50 cM (P < 0.001) for each locus. Results and discussion The END1 gene was linked to MCW0314, MCW0245, ADL164 and MCW0264 microsatellites Revista Colombiana de Ciencia Animal, Vol. 9, No. 1, 2016 33on GGA2 (p < 0.001). The small linkage group of the consensus map is showing in Fig. 2. The MCW0314, MCW0245, ADL164 and MCW0264 microsatellites have been reported by Groenen et al. (2000), Schmid et al. (2000), and used to build QTL genetic map on GGA2 in broiler whit susceptibility to develop the PHS (Rabie et al., 2005). In human, the mutations in this gene are associated with blood pressure increment, and two SNP (single nucleotide polymorphisms are related: G and T (Tanaka et al., 2004; Lee et al., 2016). The polymorphism at codon 198 in exon 5 interacts with body mass index in association with BP (Jin et al., 2003). The orthologous endothelin-1 gene human is known and conserved homology between chicken and human gene sequence (http://www.ensembl.org/Gallus_gallus/Gene/Compara_Ortholog). The increment expression END1 gene, mapping on chicken chromosome 2 in this study, has been associated at pathophysiology of PHS in broilers (Gomez et al., 2007; Wideman et al., 2013; Hassanzadeh et al., 2014; Buzala et al., 2015). However, many genes influence blood pressure, we hope to sequent SNP in this candidate gene and other like NOS3 and HIF1A genes become to association genetic with the PHS and suggested the specific combinations of alleles maybe contribute to the control this disease in broilers.AcknowledgmentsThe authors acknowledge the DIB-UN, for financing the project. ReferencesAriza, F., Harrison B., and Drinkwater D., 2001. The assignment by linkage mapping of four genes from human chromosome 22 to bovine chromosome 5 and 17. Animal Genetics, 32, 371-374. Binder, A., 2007. A review of the genetic of essential hypertension. Current Opinion in Cardiology 22, 176-184.Buzała, M., Janicki, B., Czarnecki R. 2015. Consequences of different growth rates in broiler breeder and layer hens on embryogenesis, metabolism and metabolic rate: A review. Poultry Science; 94 (4): 728-733. DOI: 10.3382/ps/pev015 Flores, V. N. 2013. Endothelin-1: intrinsic vasoconstrictor vascular endothelial. Revista Med 21(2): 64-78. http://www.scielo.org.co/pdf/med/v21n2/v21n2a08.pdfGomez, A.P., Moreno, M.J., Iglesias, A., Coral, P.X., and Hernández, A., 2007. Endothelin 1, its endothelin type A receptor, connective tissue growth factor, and adrenomedullin expression in longs of pulmonary hypertension and nonhypertensive chickens.  Poultry Science 86, 909-916.Groenen, M.A.M., Cheng, H.H., Bumstesd, N., Benkel, B.F., Elwood, B.W., Burke, B., Burt, D.W., Crittenden, L.B., Dodgson, J., Hillel, J., Lamont, S., Ponce de Leon, A., Soller, M., Takahashi, H., and Vignal, A., 2000. A consensus linkage map of the chicken genome. Genome Research 10,137-147. http://biotools.umassmed.edu/bioapps/primer3_www.cgi. Disponible en: http://www.ensembl.org/Gallus_gallus/Gene/Summary?db=otherfeatures;g=420854;r=2:62883381-62888254;t=XM_418943.4 (Consultado 09-07-2016)Hassanzadeh, M., Buyse, J., Toloei, T. and Eddy Decuypere. 2014. Ascites Syndrome in Broiler Chickens: A Review on the Aspect of Endogenous and Exogenous Factors Interactions. Japan Poultry Science Association 51: 229-241. http://www.jstage.jst.go.jp/ browse/ jpsa doi:10.2141/ jpsa.0130063Inesta, R., Guino, E., Moreno, V., 2005. Statistical analysis of genetic polymorphisms in epidemiological studies. Gaceta Sanitaria 19, 333-341.Jin, J.J., Nakura J., Wu, Z., Yamamoto, M., Abe, M., Tabara, Y., Yamamoto Y., Igase, M., Kohara, K., Miki, T., 2003. Association of endothelin-1 gene variant with hypertension. Hypertension 41, 163-167.Kalmara, I. D., Vanrompay, D., Janssensa, G. P. J. 2013. Broiler ascites syndrome: Collateral damage from efficient feed to meat conversion. The Veterinary Journal 92 (2): 169-174. http://doi.org/10.1016/j.tvjl.N2013.03.011Lee, H., Kim, HK., Won, H. et al. 2016. Genetic relationship between an endothelin 1 gene polymorphism and lead-related high blood pressure. Molecular and Cellular Toxicology 12 (2): 111. Doi:10.1007/s13273-016-0014-1Moncaleano-Vega, J., Ariza, F., and Hernández A. 2013. Association of NOS3 and HIF1α Gene Polymorphisms with the Susceptibility of Broiler Chickens to Develop Hypoxic Pulmonary Hypertension. American Journal of Hypertension Research 1.1, 17-22. DOI: 10.12691/ajhr-1-1-4Rabie, T.S.K.M., Crooijmans, R.P.M.A., Bovenhuis, H., Vereijken, A.L.J., Veenendaal, T., Van der Poel, J.J., et al. 2005. Genetic mapping of quantitative trait loci affecting susceptibility in chicken to develop pulmonary hypertension syndrome. Animal Genetics 36, 468-476.  Resnyk, C. W., Chen, C., Huang, H., Wu, CH., Simon, J., Le Bihan-Duval, E. et al. 2015. RNA-Seq Analysis of Abdominal Fat in Genetically Fat and Lean Chickens Highlights a Divergence in Expression of Genes Controlling Adiposity, Hemostasis, and Lipid Metabolism. PLoS ONE 10(10): e0139549. https://doi.org/10.1371/journal.pone.0139549Schmid, M., Nanda I., Guttenbach, M., Steinlein, C., Hoehn, H., Schartl, M., Haaf, T., et al., 2000. First report on chicken genes and chromosomes 2000. Cytogenetic Cell genetic 90, 169-218. Tanaka, C., Kamide, K., Takiuchi, S., Kawano, Y., and Miyata, T., 2004. Evaluation of the Lys198Asn and 134delA genetic polymorphisms of the Endothelin-1 gene. Hypertens Research. 27(5):367-71.Wideman, R. F., Rhoads, D. D., Erf, G. F., Anthony N. B. 2013. Pulmonary arterial hypertension (ascites syndrome) in broilers: A review. Poultry Science 92 (1): 64-83. DOI: 10.3382/ps.2012-02745

Mapa de ligamiento del gen Endotelina-1 en el cromosoma 2 del pollo

https://revistas.ut.edu.co/index.php/ciencianimal/article/download/1228/945

Mapa de ligamiento del gen Endotelina-1 en el cromosoma 2 del pollo

Abstract

Similar works

Full text

Available Versions

Universidad del Tolima: Portal der Revistas