Berg, Rolf Henrik

Buchardt, Ole

Ecker, David J.

Engholm, Michael

Møllegaard, Niels E.

Nielsen, Peter E.

Peptide nucleic acids and analogues of peptide nucleic acids are used to form duplex, triplex, and other structures with nucleic acids and to modify nucleic acids. The peptide nucleic acids and analogues thereof also are used to modulate protein activity through, for example, transcription arrest, transcription initiation, and site specific cleavage of nucleic acids

Online Research Database In Technology

   General rights Copyright and moral rights for the publications made accessible in the public portal are retained by the authors and/or other copyright owners and it is a condition of accessing publications that users recognise and abide by the legal requirements associated with these rights.   • Users may download and print one copy of any publication from the public portal for the purpose of private study or research.  • You may not further distribute the material or use it for any profit-making activity or commercial gain  • You may freely distribute the URL identifying the publication in the public portal ?  If you believe that this document breaches copyright please contact us providing details, and we will remove access to the work immediately and investigate your claim.     Downloaded from orbit.dtu.dk on: Aug 12, 2016Peptide Nucleic Acids Complexes of Two Peptide Nucleic Acid Strands and OneEcker, David J.; Buchardt, Ole; Engholm, Michael; Nielsen, Peter E.; Berg, Rolf Henrik; Møllegaard, NielsE.Publication date:1999Link to publicationCitation (APA):Ecker, D. J., Buchardt, O., Engholm, M., Nielsen, P. E., Berg, R. H., & Møllegaard, N. E. (1999). Patent No.US5986053.United States Patent [19] Ecker et al. US005986053A 5,986,053 Nov. 16, 1999 [11] Patent Number: [45] Date of Patent: [54] PEPTIDE NUCLEIC ACIDS COMPLEXES OF TWO PEPTIDE NUCLEIC ACID STRANDS AND ONE NUCLEIC ACID STRAND [75] Inventors: David J. Ecker, Leucadia, Calif; Ole Buchardt, Vaerlose, Denmark; Michael Egholm, Fredriksberg, Denmark; Peter E. Nielsen, Hjortevanget 509, DK 2980 Koddedal, Denmark; Rolf H. Berg, Rungsted Kyst, Denmark; Niels E. Mollegaard, Virum, Denmark [73] Assignees: Isis Pharmaceuticals, Inc., Carlsbad, Calif; Peter E. Nielsen, Kokkedal, Denmark [21] Appl. No.: 08/471,907 [22] Filed: Jun. 7, 1995 Related US. Application Data [60] Division of application No. 08/088,658, Jul. 2, 1993, Pat. No. 5,641,625, which is a continuation-in-part of application No. 08/054,363, Apr. 26, 1993, Pat. No. 5,539,082, which is a continuation-in-part of application No. PCT/EP92/01219, May 19, 1992, abandoned. [51] Int. Cl.6 ..................................................... .. C07K 2/00 52] US. Cl. .......................... .. 530/350; 514/44; 536/245 [58] Field of Search .............................. .. 536/245; 435/6; 530/350; 514/44 [56] References Cited U.S. PATENT DOCUMENTS 5,134,066 FOREIGN PATENT DOCUMENTS WO 92/20702 11/1992 WIPO. WO 92/20703 11/1992 WIPO. OTHER PUBLICATIONS 7/1992 Rogers et al. .......................... .. 435/91 Demidov, Vadim et al., “Sequence Selective Double Strand DNA Cleavage by Peptide Nucleic Acid (PNA) Targeting Using Nuclease S1” Nucl. Acids Res. 1993 21(19), Depto and Stenberg, “Regulated Expression of the Human Cytomegalovirus pp65 Gene: Octamer Sequence in the Promoter is Required for Activation by Viral Gene Prod ucts”, J. of Virol. 1989, 63, 1232—1238. Dubochet et al, “A NeW Preparation Method for Dark—Field Electron Microscopy of Biomacromolecules”, J. Ultra struct. Res. 1971, 35, 147—167. Egholm, M. et al., “Peptide Nucleic Acids (PNA). Oligo nucleotide Analogues With an Achiral Peptide Backbone”, J. of the Am. Chem. Soc. 1992, 114, 1895—1897. Egholm, M et al., “Peptide Nucleic Acids Containing Adenine and Guanine Recognize Thymine and Cytosine in Complementary DNA Sequences” J. Chem. Soc. Chem. Commun. 1993 800—801. Froehler et al., “Oligodeoxynucleotides Containing C—5 Propyne Analogs of 2‘—Deoxyuridine and 2‘—Deoxycyti dine”, Tetrahedron Letters 1992, 33, 5307—5310. Hahn, B.H. et al., “Molecular cloning and characterization of the HTLV—III virus associated With AIDS”, Nature 1984, 312,166—169. Lal et al., Diphenylphosphoryl AZide A Novel Reagent For The Stereospeci?c Synthesis of AZides From Alcohols, Tetrahedron Letters 1977, 23, 1977—1980. McCurdy, S. et al., “Deoxyoligonucleotides Within Inverted Polarity: Synthesis and use inTriple—Helix Formation”, Nucleosides & Nucleotides 1991, 10, 287—290. Nielsen, RB, et al., “Sequence—Selective Recognition of DNA by Strand Displacement With a Thymine—Substituted Polyamide”, Science 1991, 254, 1497—1500. (List continued on next page.) Primary Examiner—Scott W. Houtteman Attorney, Agent, or Firm—Woodcock Washburn KurtZ MackieWicZ & Norris, LLP [57] ABSTRACT Peptide nucleic acids and analogues of peptide nucleic acids are used to form duplex, triplex, and other structures With nucleic acids and to modify nucleic acids. The peptide nucleic acids and analogues thereof also are used to modu late protein activity through, for example, transcription arrest, transcription initiation, and site speci?c cleavage of nucleic acids. 2103—2107. 11 Claims, 40 Drawing Sheets PvulI PvuH pT9C-5 5, 3. 3' 5' IIIIIIHHE ‘26 5,986,053 Page 2 OTHER PUBLICATIONS Sagi et al., “Base—Modi?ed Oligodeoxynucleotides. I. Effect of 5—Alkyl,5—(1—Alkenyl) and 5—(Alkynyl) Substitution of the Pyrmidines on Duplex Stability and Hydrophobicity”, Tetrahedron Letters 1993, 34, 2191—2194. SpalholZ et al., “Bovine Papillomavirus Transcriptional Regulation: Localization of the E2—Repsonsive Elements of the Long Control Region”, J. Virol, 1987, 61, 2128—2137. Stenberg, et al., “Promoter—speci?c trans activation and repression by Human Cytomegalovirus Immediate—early Proteins Involves Common and Unique Protein Domains”, J. of Virology 1990, 64, 1556—1565. Tibanyenda et al., “The effect of single base—pair mis matches on the duplex stability of d(T—A—T— T—A—A—T—A—T—C—A—A—G—T—T—G) d(C—A—A—C—T— T—G—A—T—A—T—T—A—A—T—A)”, Eur J. Biochem. 1984, 139, 19—27. Vasseur, J. —J. et al., “Oligonucleosides; Synthesis of Novel Methylhydroxylamine—Linked Nucleoside Dimer and Its Incorporation into Antisense Sequences”,J. Am. Chem. Soc. 1992, 114, 4006—4007. Vickers, T. et al., “Inhibition of HIV—LTR gene expression by oligonucleotides targeted to the TAR element”, Nucleic Acids Research 1991, 19(12), 3359—3368. Almarsson, O. et al., “Molecular Mechanics Calculations of the Structures of Polyamide Nucleic Acid DNA Duplexes and Triple Helical Hybrids” Proc. Natl. Acad. Sci. USA 1993, 90(16), 7518—7522. Almarsson. O. et al., Peptide Nucleic Acid (PNA) Confor mation and Polymorphism in PNA—DNA and PNA—RNA hybrids. Proc. Natl. Acad. Sci. USA 1993, 90(20), 9542—9546. BroWn et al., “NMR Solution Structure of a Peptide Nucleic Acid Complex With RNA” Science 1994, 265, 777—780. Chen et al., “Molecular Dynamics and NMR Studies of Single—Stranded PNA’s” Tetrahedron Lett. 1994, 35 (29), 5150—5108. Demidov et al., “Stability of Peptide Nucleic Acides in Human Serum and Cellular Extracts” Biochem. Pharmacol. 1994, 48(6), 1310—1313. Dueholm et al., “An Ef?cient Synthetic Approach to Boc—aminoacetaldehyde and Its Application in the Synthesis of 2—Boc—aminoethylglycine Methl Ester” Org. Prep. Proc. Int. 1993, 25, 457—461. Dueholm et al., “Peptide Nucleic Acid (PNA) With a Chiral Backbone Based on Alanine” Bioorg. Med. Chem. Lett. 1994, 4(8), 1077—1080. Dueholm et al., “Synthesis of Peptide Nucleic Acids Mono mers Containing the Four Natural Nucleobases: Thymine, Cytosine, Adenine and Guanine, and Their OligomeriZa tion”, J. Org. Chem 1994, 59(19), 5767—5773. Egholm et al., Recognition of Guanine and Adenine in DNA by Cytosine and Thymine Containing Peptide Nucleic Acids (PNA), J. Am. Chem. Soc. 1992, 114, 9677—9678. Flam, E, “Can DNA Mimics Improve on the Real Thing?” Science 1993, 262, 1647—1649. Frank—Kamenetskii, M., “A Change of Backbone” Nature 1991, 354, 505. Grif?th et al., “Single and Bis Peptide Nucleic Acids as Triplexing Agents: Binding and Stoichiometry” J. Am. Chem. Soc., 1995, 117(2), 831—832. Hyrup et al. “Modi?cation of the Binding Affinity of Peptide Nucleic Acids (PNA). PNA With Extended Backbones Con sisting of 2—aminoethyl—B—alanine or 3—aminopropylgly cine Units” J. Chem. Soc. Chem. Comm. 1993, 518—519. Hyrup et al., “Structure—activity Studies of the Binding of Modi?ed Peptide Nucleic Acids (PNA) to DN ” J. Am. Chem. Soc. 1994, 116(18), 7964—7970. Kosynkina L. et al., “A Convenient Synthesis of Chiral Peptide Nucleic Acid (PNA) Monomers” Tetrahedron Lett. 1994, 35(29), 5173—5176. Lagriffoul et al., “The Synthesis, CooligomeriZation and HybridiZation of a Thymine—thymine Heterodimer Contain ing PNA” Bioorg. Med. Chem. Lett. 1994, 4(8), 1081—1082. Leijon et al., “Structural CharacteriZation of PNA—DNA Duplexes by NMR. Evidence for DNA in a B—like Confor mation” Biochemistry 1994, 33(33), 9820—9825. Mollegaard et al., “Peptide Nucleic Acid—DNA Strand Dis placement Loops as Arti?cial Transcription Promoters” Proc. Natl. Acad. Sci. USA 1994, 91(9), 3892—3895. Nielsen et al., “Peptide Nucleic Acids (PNA). Potential Anti—Sense and Anti—Gene Agents” Anticancer Drug Des., 1993, 8(1), 53—63. Nielsen, P.E., “Peptide Nucleic Acids (PNA): Potential Antiviral Agents” Int’l. Antiviral News 1993, 1, 37—39. Nielsen et al., “Peptide Nucleic Acids (PNA). DNA Ana logues With a Polyamide Backbone”Antisense Research and Applications, CRC Press, 1993, pp. 363—373. Nielsen, P.E., “Peptide Nucleic Acid (PNA): AModel Struc ture for the Primordial Genetic Material” Orig. Life Evol. Biosph. 1993, 23(5—6), 323—327. Nielsen et al., “Peptide Nucleic Acid (PNA). A DNA Mimic With a Peptide Backbone” Bioconjugate Chem. 1994, 5(1), 3—7. Nielsen et al., “Sequence—speci?c Transcription Arrest by Peptide Nucleic Acid Bound to the DNA Template Strand”, Gene 1994, 149(1), 139—145. Orum et al., “Single Base Pair Mutation Analysis by PNA Directed PCR Clamping”, Nucleic Acids Res. 1993, 21(23), 5332—5336. Peffer et al., “Strand—Invasion of Duplex DNA by Peptide Nucleic Acid Oligomers” Proc. Natl. Acad. Sci. USA 1993, 90(22), 10648—10652. Rose, D.J., “Characterization of Antisense Binding Proper ties of Peptide Nucleic Acids By Capillary Gel Electro phoresis” Anal. Chem. 1993, 65(24), 3545—3549. Wittung et al., “DNA—like Double Helix Formed by Peptide Nucleic Acid” Nature 1994, 368, 561—563. U.S. Patent Nov. 16,1999 Sheet 2 0f 40 5,986,053 DNA? pUC19 pTQC pT9C—5 pNA: - 1 1 1 - 1 - 2 3 1 Enzyme? Bomb-l1 S1 15 3030 0 0 30303030 +Nc| 12345678910 FIG. 2 U.S. Patent Nov. 16,1999 Sheet 3 0f 40 5,986,053 I ’. ‘‘ liaul‘l‘llnllllll‘l. 2HO98765432I FIG.3 U.S. Patent Nov. 16,1999 Sheet 5 0f 40 5,986,053 PNA/DNA 0 0.006 0.02 0.06 0.2 0.6 Pvull BamHl Pvull L_L__i PW" BamHl 211 bp Pvull Ba H1 I 111 hp‘ PNA Target 5' ---- —-GGA'I‘CCAAAAAAAAAAGGATCC ----- - 3 ’ ---- - — CCTAGGTTTTTTTTTTCCTAGG ————— - — BamHl BamHl FIG.5 U.S. Patent Nov. 16,1999 Sheet 6 0f 40 5,986,053 120 100 80 40 60 Time (min) 20 FIG.6 “83:80 Axe Dissociation Temperature FIG.7 U.S. Patent Nov. 16,1999 Sheet 7 0f 40 5,986,053 FIG.8 U.S. Patent Nov. 16,1999 Sheet 8 0f 40 5,986,053 TTCTTCTTTT GHEGTC TT-cTTcTTT-T /SHEET-C CTGCHG d - - TTCTTCTITTIT CTIGEHG /) FIG.9 U.S. Patent Nov. 16,1999 Sheet 9 0f 40 5,986,053 s1 KMnO4 DMS + + + + + + + + + PNA c - 123456789101112135 TCTTC T AAGAAGAAAA , \, its’;FIG.|O U.S. Patent Nov. 16,1999 Sheet 10 0f 40 5,986,053 DMS -+++ ¢1s9s KMnO4 c-+++ 123455 PNA "it"s" AAGAAGAAAA -:___ U.S. Patent Nov. 16,1999 Sheet 11 0f 40 5,986,053 DMS KMBO4 5.5 6.5 7.5 7.5 6.5 5.5 TTTTCTTCTT Z-s'ilZ. f..32m w / _- ¢an¢¢¢¢ .0‘0900“ _-_.-.. ...... ...‘.-.> _-: ....¢.¢ n ‘a ‘.911. AAGAAGAAAA , i O I: ' ‘-0 ..‘.¢.0 "0...‘ O. _ U.S. Patent Nov. 16,1999 Sheet 12 0f 40 5,986,053 .I3A FIG. I38 FIG FIG. I30 U.S. Patent Nov. 16,1999 Sheet 13 0f 40 5,986,053 2514-2 FIG m 26x42 .ruw4T T 1‘ _dJA7 654.32In 0mwJDQwJOE 0mmEDZHt.0 no 204 so 40 so 50 70 a0 90 I00 LENGTH, % FIG. l4 U.S. Patent Nov. 16,1999 Sheet 14 0f 40 5,986,053 pA98 pUC19 PNA + - + - 12 3 4 Ist Dimension2nd Dimension (Chloroquine) FIG.I6 U.S. Patent Nov. 16,1999 Sheet 15 0f 40 5,986,053 FIG.I7A PNA + I FIG. ITB H =1 alanlsl? U.S. Patent Nov. 16,1999 Sheet 16 0f 40 5,986,053 PNA ---I|IOIO PBXPXPX l234567 ' ‘i! . Q "— Pvull l p; . <——Xbo1 . U Q. <—-BomHI U.S. Patent Nov. 16,1999 Sheet 17 0f 40 PNA - + - I 2 3 P8‘ ‘9- PvuII FIG.|9 5,986,053 U.S. Patent Nov. 16,1999 Sheet 18 0f 40 5,986,053 N O_ m w ONQE m I. EH24 \ E 5

Peptide Nucleic Acids Complexes of Two Peptide Nucleic Acid Strands and One

http://orbit.dtu.dk/ws/files/58073375/US5986053.pdf

Peptide Nucleic Acids Complexes of Two Peptide Nucleic Acid Strands and One

Abstract

Similar works

Full text

Available Versions

Online Research Database In Technology