A new species of Isospora is described from the fecal contents of the white-chinned woodcreeper, Dendrocincla merula merula from Guyana and Dendrocincla merula barletti from Peru. Sporulated oocysts are subspherical to ovoid, 19.2 × 16.5 (15–23 × 14.5–19) μm, with a smooth, colorless, bilayered wall. The average shape index is 1.2. No micropyle or oocyst residuum are present, but the oocysts contain one polar granule. Sporocysts are ovoid, 12.9 × 8.3 (12–14 × 7–10) μm, average shape index of 1.7 with a smooth, single layered wall and composed of a small, knoblike Stieda body and a slightly larger, bubble shaped substieda body. The two sporocysts each contain a compact residuum composed of coarse, non-uniform granules and four randomly arranged, vermiform sporozoites each with a terminal refractile body and a centrally located nucleus. DNA sequences representing ITS-1 and ITS-4 regions of the 5.8S rDNA gene from the two isolates were amplified and compared. In addition to the two isolates showing similar morphological characteristics, they also had identical nucleotide sequences for the ITS-1 and ITS-4 regions of the 5.8S ribosomal gene

Capparella, Angelo P.

Galewsky, Samuel

McQuistion, Thomas E.

Rebling, Fredrick

Portal Czasopism Naukowych (E-Journals)

Acta Protozool. (2010) 49: 121–124 
http://www.eko.uj.edu.pl/apACTA
PROTOZOOLOGICA
Isospora dendrocinclae n. sp. (Apicomplexa: Eimeriidae) from the White-
chinned Woodcreeper (Dendrocincla merula) from South America
Thomas E. McQUISTION1, Samuel GALEWSKY1, Angelo P. CAPPARELLA2 and Fredrick 
REBLING3
1Department of Biology, Millikin University, Decatur, Illinois; 2Department of Biological Sciences, Illinois State University, Normal, 
Illinois; 3George Washington University, Washington, D.C. USA
Summary. A new species of Isospora is described from the fecal contents of the white-chinned woodcreeper, Dendrocincla merula merula 
from Guyana and Dendrocincla merula barletti from Peru. Sporulated oocysts are subspherical to ovoid, 19.2 × 16.5 (15–23 × 14.5–19) 
µm, with a smooth, colorless, bilayered wall. The average shape index is 1.2. No micropyle or oocyst residuum are present, but the oocysts 
contain one polar granule. Sporocysts are ovoid, 12.9 × 8.3 (12–14 × 7–10) µm, average shape index of 1.7 with a smooth, single layered 
wall and composed of a small, knoblike Stieda body and a slightly larger, bubble shaped substieda body. The two sporocysts each contain 
a compact residuum composed of coarse, non-uniform granules and four randomly arranged, vermiform sporozoites each with a terminal 
refractile body and a centrally located nucleus. DNA sequences representing ITS-1 and ITS-4 regions of the 5.8S rDNA gene from the two 
isolates were amplified and compared. In addition to the two isolates showing similar morphological characteristics, they also had identical 
nucleotide sequences for the ITS-1 and ITS-4 regions of the 5.8S ribosomal gene. 
Key words: Isospora dendrocinclae, Passeriformes, Dendrocolaptidae, phylogenetics, ribosomal RNA, molecular systematics.
Address for correspondence: Thomas E. McQuistion, Department 
of Biology; Millikin University, Decatur, Illinois 62522, U.S.A. 
(217) 424-6236; Fax (217) 424-3958; E-mail: tmcquistion@milli-
kin.edu
INTRODUCTION
The white-chinned woodcreeper’s (Dendrocincla 
merula) range mainly covers lowland Amazonia and 
includes the eastern regions of Colombia, Ecuador, and 
Peru; northern Bolivia; Amazonian Brazil; the Guianas; 
and southern Venezuela (Ridgely and Tudor 1994). They 
forage largely in pairs or small family groups for inver-
tebrates, and are often associated with army ant swarms 
(del Hoyo et al. 2003). Like other undergrowth tropical 
birds that inhabit primarily terra firme forest, they are 
thought to be sedentary (Capparella 1988, Brown et al. 
2004). There are no reports of coccidian parasites from 
D. merula. This paper describes a new isosporan parasite 
from two Dendrocincla merula populations collected in 
Guyana and Peru at opposite ends of D. merula’s range. 
In addition to morphological comparison between 
the two isosporan isolates from D. merula, genetic anal-
ysis of the ribosomal Internal Transcribed Spacer (ITS1 
and ITS4) were isolated and amplified to compare ge-
netic similarity (Barta 2001). 
T. E. McQuistion et al.122
MATERIALS AND METHODS
Oocyst collection
Fecal samples were collected from six white-chinned wood-
creepers during a bird collecting expedition in June 1996 from 
Guyana and Peru. Upon collection, the fecal samples were placed 
in 2.5% (w/v) K2Cr2O7 and maintained at cool temperatures in the 
field. Upon arrival at the laboratory, the samples were processed and 
examined as described by McQuistion and Wilson (1989). A Nikon 
Labophot microscope with an optical micrometer and a dark box 
with a HFX-DX photomicrographic attachment were used to mea-
sure and photograph the oocysts. All measurements are given in mi-
crometers with the size ranges in parenthesis following the means. 
Oocysts were two months old when originally examined, measured, 
and photographed.
DNA isolation, amplification, and sequencing
A Qlamp DNA Stool Mini Kit (Qiagen GmbH, Hilden, Ger-
many) was used to extract the DNA from the oocysts. The manu-
facturer’s DNA isolation protocol was followed with the following 
modifications. The InhibitEX (inhibitor-adsorption tablets) were 
not used. Instead, oocysts from the Guyana and Peru isolates were 
cleaned with standard bleach and washed three times in 0.9% saline 
solution. Before the first incubation step (as indicated in the proto-
col) 3 mm sterile glass beads (Kimble Glass, Vineland, New Jersey) 
were added to the microcentrifuge tube containing the oocysts and 
the mixture was vortexed for 5 minutes to disrupt the oocysts for 
extraction of the DNA. 
PCR amplification was carried out using a Perkin Elmer® Gene 
Amplication (PCR) System. The PCR mixture was 1 µl of DNA, 
2 µl ITS-1, 2 µl ITS-4 and 5 µl Master Mix® (Promega Biotech, 
USA). The mixture was placed in a PCR tube and amplified by the 
technique described by Barta et al. (1998). The sequence chosen 
for DNA analysis was the Internal Transcribed Spacer (ITS). The 
primers used for PCR were ITS-1 (5’>3’) TCCGTAGGTGAACCT-
GCGG and ITS-4 (5’>3’) TCCTCCGCTTATTGATATGC (Barta et 
al. 1998). The primers were obtained from Sigma Genosys (USA) 
and used at a concentration of 30 ng/µl. The desired product was 
extracted from agarose gel using a QlAquick Gel Extraction Kit 
(QlAGen Sciences, Maryland, USA) and the manufacturer’s proto-
col was followed without modification.
DNA sequencing was conducted using the Big Dye PCR 
Cycle Sequencing System and an Automated Fluorescents DNA 
Sequencer. FinchTV version 1.4 (www.Geospiza.com) was used to 
view the DNA sequence. The Basic Local Alignment Search Tool 
(BLAST)(http:www.ncbi.nlm.nih.gov/blast) was used to compare 
obtained sequence fragments with known parasite lineages. 
RESULTS
Isospora dendrocinclae n. sp. (Figs 1, 2)
Description of oocysts from type host: Sporulated 
oocysts are subspherical to ovoid, 19.2 × 16.5 (15–23, 
SD = 1.5 × 14.5–19, SD = 0.90 (N = 30) with a smooth, 
bilayered wall; the inner wall is thinner and darker than 
the outer wall. The shape index (length/width) is 1.2 
(1.1–1.3, SD = 0.07). Micropyle and oocyst residuum 
are absent but one, subspherical, rough polar granule is 
present. Sporocysts are ovoid, 12.9 × 8.3 (12–14, SD = 
0.80 × 7–10, SD = 0.61); shape index is 1.7 (1.6–1.8, 
SD = 0.09). The Stieda body is small and knoblike and 
the substieda body is slightly larger than the Stieda body 
and subglobular. Each sporocyst contain a subspherical 
residuum composed of coarse, non-uniform granules 
and four vermiform sporozoites randomly arranged in 
the sporocyst with a terminal, posterior refractile body 
and a centrally located nucleus.
Type host: Dendrocincla merula merula (Lich-
tenstein, 1820) white-chinned woodcreeper (Passeri-
formes: Dendrocolaptidae).
Type specimens: A phototype series and buffered 
formalin-preserved sporulated oocysts of Isospora 
dendrocinclae sp. n. are deposited in the Harold W. 
Manter Laboratory of Parasitology, University of Ne-
braska State Museum, Lincoln, Nebraska 68588, acces-
sion no. HWML 63509 (syntypes) and HWML 49088 
(phototypes).
Type locality: Guyana, Iwokrama Reserve, Kabo-
calli Landing, West bank of Essequibo River, ca. 45 
river miles SE Kurupukari. 4°17′′N, 58°31′′W.
Location of symbiotype host specimen: Academy 
of Natural Sciences, Philadelphia, Museum no. ANSP 
188562.
Other host: Dendrocincla merula bartletti Chubb, 
1919.
Other host locality: Peru, Loreto Departamento, 79 
km WNW of Contamana, ca. 400m elevation, 7°8′S, 
75°41′′W.
Prevalence: 1/1 (100%) from Guyana location, 5/13 
(38%) from Peru location.
Sporulation time: Unknown; oocysts were partially 
sporulated when received at the laboratory and became 
fully sporulated after exposed to air for several days 
prior to examination.
Site of infection: Unknown, oocysts found in feces.
Etymology: The specific epithet, dendrocinclae, is 
the Latin genitive form of the host genus name.
DNA analysis
DNA amplification of the Guyana and Peru isolates 
showed clear bands around 400 bp. The 5.8S rDNA 
sequence alignment indicated an identical sequence 
(100%) between the two isolates. The nucleotide se-
New Isospora from Woodcreeper 123
Fig. 1. Composite line drawing of sporulated oocyst of Isospora 
dendrocinclae n. sp. from the white-chinned woodcreeper, Dendro-
cincla merula. Scale bar: 10 µm.
Fig. 2. Bright field photomicrograph of sporulated oocyst of Isos-
pora dendrocinclae n. sp. from the white-chinned woodcreeper, 
Dendrocincla merula. Scale bar: 10 µm.
quences for the isolates are deposited in GenBank. The 
Guyana isolate accession number is GU952797 and the 
Peru isolate accession number is GU952798.
DISCUSSION
The white-chinned woodcreeper has seven named 
subspecies (Peters 1951). Two of the subspecies (nomi-
nate merula and obidensis) are distributed north of the 
Amazon River and east of the Rio Negro River and may 
constitute the single subspecies, D. m. merula, based on 
size, iris color and vocalizations (del Hoyo et al. 2003). 
D. m. bartletti (the Peru subspecies sampled) is confined 
to southern Venezuela on the upper Orinoco River south 
to northern Peru. Therefore, Isospora dendrocinclae 
was found in two subspecies of woodcreeper, one con-
taining nominate merula and one containing nominate 
bartletti. No morphological differences were apparent 
between sporulated oocysts from these two coccidian 
isolates and the DNA sequences of ITS-1 and ITS-4 re-
gions of their 5.8S ribosomal gene were identical. 
Five isosporoid coccidia have been previously de-
scribed and compared from three woodcreeper species 
in the family Dendrocolapidae (McQuistion and Cap-
parella 1997). All three avian host species are sympatric 
with Dendrocincla merula in part of its range. Isospo-
ra magna and I. concentrica were described from the 
barred woodcreeper Dendrocolaptes certhia (McQuis-
tion and Capparella 1995). Their oocysts and sporo-
cysts are much larger than those of I. dendrocinclae. 
The oocysts of I. magna average 29.7 × 24.9 µm and I. 
concentrica average 26.6 × 22.7 µm compared to 19.2 × 
16.5 µm for I. dendrocinclae. The sporocysts of I. mag-
na average 15.8 × 12.6 µm and those of I. concentrica 
average 17.2 × 11 µm compared to 12.9 × 8.3 µm for 
T. E. McQuistion et al.124
sporocysts of I. dendrocinclae. In addition, the shape 
indexes of the sporocysts are different for the three coc-
cidian species; 1.3 for I. magna, 1.6 for I. concentrica, 
and 1.7 for I. dendrocinclae. Other differences between 
the three coccidian species include shape of the Stieda 
and substieda body on the sporocysts and the number 
of refractile bodies and unique characteristics of the 
sporozoites. The Stieda bodies of I. magna are broad, 
dome-like with an inconspicuous substieda body lo-
cated directly below the Stieda body but slightly to the 
left or right of the vertical axis with a wavy lower sur-
face. The Stieda bodies of I. concentrica are square or 
block-shaped with a bubble-shaped substieda body. The 
Stieda bodies of I. dendrocinclae are knoblike with a 
subglobular substieda body. Additionally, there are sig-
nificant differences between the sporozoites of the three 
isosporan species. The sporozoites of I. magna are sau-
sage-shaped and contain refractile bodies at each end 
of the sporozoite while I. concentrica have striations 
marking the anterior half of the sporozoite. In compari-
son, the sporozoites of I. dendrocinclae are vermiform 
with one terminal refractile body and no striations.  
Isospora ubique was described from the wedge-
billed woodcreeper, Glyphorynchus spirurus (McQuis-
tion and Capparella 1997). I. ubique oocysts are larger 
(23.4 × 21.8 µm) than I. dendrocinclae (19.2 × 16.5) 
and subspherical (shape index is 1.07 for I. ubique com-
pared to 1.2 for I. dendrocinclae. The sporocysts of I. 
ubique have no substieda bodies and contain a scattered 
residuum compared to the subglobular substieda bod-
ies and condensed, subspherical residuum of I. dendro-
cinclae.  Isospora ocellati and I. striata were described 
from the ocellated woodcreeper, Xiphorhynchus ocella-
tus ( McQuistion et al. 1996). Although their oocysts are 
similar in size and shape compared to I. dendrocinclae, 
I. striata has striations around the anterior end of the 
sporozoites and rectangular shaped substeida bodies on 
the sporocysts while I. dendrocinclae has no striations 
on the sporozoites and subglobular shaped substieda 
bodies. Sporocysts of Isospora ocellati are shorter than 
I. dendrocinclae (11 x 8 µm vs. 12.9 × 8.3 µm) with 
a dome-like Stieda body, ellipsoidal substieda body, 
and scattered residuum compared to the knoblike Stieda 
bodies, subglobular substieda bodies and compact, sub-
spherical sporocyst residuum of I. dendrocinclae. 
Acknowledgements. The authors thank Ms Aidan Parrish for the 
line drawing and the Academy of Natural Sciences of Philadelphia 
for funding the bird collecting expedition.
REFERENCES
Barta J. R., Coles B. A., Schito M. L., Fernando M. A., Martin A., 
Danforth H. D. (1998) Analysis of infraspecific variation among 
five strains of Eimeria maxima from North America. Interna-
tional J. Parasitol. 28: 485–492
Barta J. R. (2001) Molecular approaches to inferring evolutionary 
relationships among protistan parasites. Vet. Parasitol. 101: 
175–186
Brown L. M., Ramey II R. R., Tamburini B., Gavin T. A. (2004) 
Population structure and  mitochondrial DNA variation in sed-
entary Neotropical birds isolated by forest  fragmentation. Con-
serv. Genet. 5: 743–757
Capparella A. P. (1988) Genetic variation in Neotropical birds: Im-
plications for the speciation process. Acta Congressus Interna-
tionalis Ornithologici 19: 1658–1664
del Hoyo J., Elliott A., Christie D. A. eds. (2003) Handbook of the 
Birds of the World. Vol. 8: Broadbills to Tapaculos. Lynx Edi-
tions, Barcelona, Spain
McQuistion T. E., Wilson M. (1989) Isospora geospizae, a new 
coccidian parasite (Apicomplexa: Eimeriidae) from the small 
ground finch (Geospiza fuliginosa) and the medium ground 
finch (Geospiza fortis) from the Galapagos Islands. Syst. Para-
sitol. 14: 141–144
McQuistion T. E., Capparella A. P. (1995) Two new isosporan para-
sites (Apicomplexa: Eimeriidae) from the South American woo-
creeper Dendrocolaptes certhia. Acta Protozool. 34: 299–302
McQuistion T. E., Walden K. K., Capparella A. P. (1996) Two new 
species of Isospora (Apicomplexa: Eimeriidae) from the ocel-
lated woodcreeper, Xiphorhynchus ocellatus (Passeriformes: 
Dendrocolaptidae). Arch. Protistenk. 147: 401–404
McQuistion T. E., Capparella A. P. (1997) Isospora ubique: 
A new coccidian parasite from the wedge-billed woodcreeper 
(Glyphorynchus spirurus) from South America. Acta Protozool. 
36: 75–78
Peters J. L. (1951) Check-list of Birds of the World. Vol. VII. Mu-
seum of Comparative  Zoology, Harvard University, Cambridge, 
Massachusetts
Ridgley R. S., Tudor G. (1994) The Birds of South America. Univer-
sity of Texas Press,  Austin, Texas
Received on 25th  September, 2009; revised on 8th March, 2010; 
accepted on 13th March, 2010


Isospora dendrocinclae n. sp. (Apicomplexa: Eimeriidae) from the Whitechinned Woodcreeper (Dendrocincla merula) from South America

http://www.ejournals.eu/sj/index.php/AProto/article/download/3847/3771

Isospora dendrocinclae n. sp. (Apicomplexa: Eimeriidae) from the Whitechinned Woodcreeper (Dendrocincla merula) from South America

Abstract

Similar works

Full text

Available Versions

Portal Czasopism Naukowych (E-Journals)