DNA fragment of landomycin E biosynthesis gene cluster 1.5 kb in size has been completely sequenced and two open reading frames were identified. Gene lndZ1 resembles NDP-hexose-3,5-epimerase and lndZ3 is similar to NDP-hexose-4-ketoreductases. LndZ1 and LndZ3 proteins are suggested to accomplish two last catalytic steps towards deoxysugar L-rhodinose present in landomycin E carbohydrate moietyThis work was supported by grant BG-117b from Ministry of Education and Science of Ukraine (to V.F). We are gratefull to the staff of DNA sequencing facility at the Dept. of Biochemistry of Cambridge University (John Lester, Tania Mironenko, Nataliya Scott) for help in
sequencing

Fedorenko, V

Kozarevska, I

Ostash, B

Samborskyy, M

English

Apollo (Cambridge)

ВІСНИК ЛЬВІВ. УН-ТУ VISNYK OF L’VIV UNIV. Серія біологічна. 2004. Вип. 38. С. 92-98 Biology series. 2004. Is. 38. P. 92-98  ©   Kozarevska I., Ostash B., Samborskyy M., Fedorenko V., 2004 УДК 238.218.60 BIOSYNTHESIS OF LANDOMYCIN E DEOXYSUGAR PART IN STREPTOMYCES GLOBISPORUS 1912: SEQUENCING AND ANALYSIS OF LNDZ1 AND LNDZ3 GENES  I. Kozarevska, B. Ostash, M. Samborskyy, V. Fedorenko Ivan Franko National University of L’viv  Hrushevskogo Str., 4, L’viv, 79005, Ukraine e-mail: v_fedorenko@franko.lviv.ua DNA fragment of landomycin E biosynthesis gene cluster 1.5 kb  in size has been completely sequenced and two open reading frames were identified. Gene lndZ1 resembles NDP-hexose-3,5-epimerase and lndZ3 is similar to NDP-hexose-4-ketoreductases. LndZ1 and LndZ3 proteins are suggested to accomplish two last catalytic steps towards deoxysugar L-rhodinose present in landomycin E carbohydrate moiety. Key words: Streptomyces, angucyclines, L-rhodinose biosynthesis, landomycin E. Many clinically usefull antibiotics contain carbohydrates [4, 13] (fig. 1). Sugars often define the mode of antibiotics action, it’s pharmacokinetics and metabolism [4]. There is grow-ing body of data that rational manipulations with carbohydtrate biosynthesis is perspective route towards generation of novel bioactive compounds [5,11]. Landomycin E (LaE) is angucycline antibiotic whose molecule consists of polyketide framework (landomycinone) modified with trisaccharide D-olivose-D-olivose-L-rhodinose. Landomycin A (LaA) is relative antibiotic where the same deoxysugar motif is repeated twice [2] (fig. 1). Both antibiotics exhibit antitumor and antibacterial activities. Anitumor activity of landomycins elevates as the length of sugar tail increases [8]. These findings prompted us to initiate systematic studies on genes governing LaE deoxysugar biosynthesis. Particularly we are Fig. 1. Structures of landomycins А and Е (LaA, LaE) [8]. Polyketide moiety of  mentioned landomy-cins  is identical, the difference lies in structure of glycoside chains (R). OHO CH3OHOOHOROH3COOCH3HOHOOOH3COOH3COOCH3HOHOOOH3CHOOH3COOCH3HOOOH3CHOR= LaA LaE R= BIOSYNTHESIS OF LANDOMYCIN E ... 93  interested in identification of genes responsible for L-rhodinose formation. Manipulations with these genes will help us to elucidate the substrate specificity of glycosyltransferases involved in LaE production and to generate novel LaE derivatives.  Here we report complete sequencing of two genes lndZ1 and lndZ3 which are likely in-volved in the last steps of L-rhodinose formation.  Gene cluster for LaE biosynthesis (lnd) in S. globisporus 1912 has been partially sequenced and studied through directed mutagenesis [1,6-8, 10]. The cluster for LaE biosynthesis was shown to be widely congruent in it’s general architec-ture with LaA biosynthetic gene cluster (lan) from S. cyanogenus S136 [10,15] (fig. 2). Down-stream of possible antiporter gene lanJ 4 genes were identified – lanZ1, lanZ2, lanGT3, lanZ3 (fig. 2, A). Two of them,  lanZ1 and lanZ3 are supposed to be responsible for biosynthesis of L-rhodinose molecule [15], whereas lanZ2 and lanGT3 genes encode possible hexose-synthase and glycosyltrasnferase, respectively, involved in hexasaccharide chain synthesis [14,15]. Re-spective region of lnd  cluster was only partially sequenced. Thus we have decided to complete sequencing of this region and compare it’s organization with that of lan cluster.  Plasmid pUC3.5Pst1 (fig. 2, B) was subcloned as SmaI and SacI fragments into pUC18 and resulting plasmids were subjected to terminal sequencing from both ends using standard  M13p universal and reverse primers.  Nucleotide sequence was determined by dideoxynucleo-tide chain termination method on ALF Express sequencer (Pharmacia). The sequence was ana-lyzed and aligned with the GCG sequence analysis software package (version 8; Genetics Com-puter Group, Madison, Wis.) and GeneDoc (version 2.6.002). BLAST X searches were per-formed to find lndZ1 and lndZ3 homologues. Conserved domain search was done with CDD S S  S S Sm Sm Sm lanZ1 lanGT3 lanZ2 lanZ3 lanGT4 lndJ lndZ1 lndZ3 lndGT4 pUC3.5 PstI pIK1 pIK2 pIK3 pIK4 pIK5 pIK6 1 kb A. B. Fig. 2. A. Organization of fragment of S. cyanogenus S136 lan cluster. Gene functions are given in [15].  B. Genetic and restriction map of fragment of S. globisporus 1912 lnd cluster. Gene functions – see [1].  Below subclones are shown used for sequencing. Abbreviations: S – SacI, Sm – SmaI.   lanJ 94 I. Kozarevska, B. Ostash, M. Samborskyy, V. Fedorenko  engine (NCBI server) and phylogenetic trees were built using DNASTAR software (CLUSTAL W algorithms).  GenBank accession numbers to lndZ1 and lndZ3 sequences are AY608714 and AY608715, respectively. Gene lndZ1 begins with ATG which is preceded by putative RBS (GAGG) 5 nt upstream of lndZ1. First in-frame stop codon (TGA) is recognized  570 bp downstream of start codon, thus specifying  190 aa protein. Gene lndZ3 starts from unusual valine codon (GTG). It is sepa-rated by 8 nt sequence from lndZ1 stop codon. Putative RBS for lndZ3 is identified 34 nt uspream  of start codon, thus lying in lndZ1 coding sequence. First in-frame stop codon (TGA) lies 927 nt downstream of lndZ3 start codon defining 309 aa protein. Sequencing was per-formed beyond lndZ3 stop codon up to the 5’-end of lndGT4 gene [8]. 57 bp intergenic se-quence separates lndZ3 and lndGT4. No nucleotide motifs typical for Streptomyces promoters [12] could be identified within this region. Taking into account these data and previous studies on lndGT4lndZ4lndZ5 genes [8], we suggest tentatively that genes lndZ1lndZ3lndGT4lndZ4lndZ5 form single transcriptional unit. At this moment we have no sequences upstream of lndZ1 long enough to perform promoter searches. It is possible that lndJ transporter gene also falls into this transcriptional unit. Further sequencing will clarify this question. Genes lndZ1 and lndZ3 have high GC content (68 and 74%, respectively) with strong bias towards GC usage in third codon position, typical for streptomycete genes [12]. Probable product of lndZ1 translation shows 85% of identity and 91% of similarity to putative NDP-hexose-3,5-epimerase LanZ1 from S.cyanogenus S136 lan cluster [15], 61% and 69% to rhamnose-3,5-epimerase Gra-orf25 from S.violaceoruber granaticin biosynthesis gene cluster (GenBank accession number - CAA09646), 49 and 58% to possible epimerase  UrdZ1 from urdamycin producing  S.fradiae [3]. Putative LndZ3 exhibits 62% of identity and 72% of similarity to putative NDP-hexose-4-ketoreductase LanZ3 from lan cluster [15], 46% and 58% to hexose-ketoreductase UrdZ3 from urdamycin cluster [3], 45 and 53% to NanG4, presumed hexose-4-ketoreductase involved in biosynthesis of polyether nanchangmycin by S. nanchan-gensis (AAP42863), 40 and 49% to diphospho-4-keto-2,3,6-trideoxyhexulosoreductase DnmV from daunorubicin gene cluster of S.peucetius (AAB63047), 36 and 46% to hexose-4-ketoreductase SnoG from nogalamycin producer S.nogalater (AAF01816).  In general all BLAST hits to both sequenced genes fall into single group of enzymes catalyzing last steps of deoxysugar formation. CDD searches and phylogenetic comparisons (fig. 3, A, B) also indicate that LndZ1 is NDP-hexose-3,4-epimerase and LndZ3 is NDP-hexose-4-ketoreductase. These enzymes are suggested to be involved in two last sequential steps of L-rhodinose formation (fig. 4). Further gene knockout experiments will be performed to substantiate this speculation. Genes lndZ1 and lndZ3 are separated by 8 nt spacer (fig. 5), whereas in lan cluster two additional genes lanZ2 and lanGT3 are localized between lanZ1,  lanZ3 [15]. Detailed compara-tive analysis of lan and lnd nucleotide sequences allowed us to speculate, that there was dele-tion within lnd cluster 2806 bp in length (comprising entire orfs for lanZ2 and lanGT3 homo-logues) which was substituted with insertion of 401 bp sequence restoring correct in-frame stop codon of lndZ1 and start codon of lndZ3. Comparison of LndZ1 and LndZ3 putative aminoacid sequences shows that 7 residues of LanZ1 (SEWPGGN) are substituted in LndZ1 with APCAA. LndZ3 starts with valine V, which corresponds to 10th aminoacid of LanZ3. Thus first nine ami-noacids (MTGTGGQRR)  found in LanZ3 are absent in LndZ3. Interestingly that UrdZ3 from urdamycin gene biosynthetic cluster of S.fradiae has the same truncated N-terminus as LndZ3 has [3].  The data presented indicate that deletion occurred in evolutionary history of S. globis-BIOSYNTHESIS OF LANDOMYCIN E ... 95  Nucleotide Substitutions (x100)078.710203040506070CouWNovWMydHRmlCDnmUOrf4AveBVLndZ1LanZ1UrdZ1Gra-orf25TylCVIINucleotide Substitutions (x100)0105.920406080100LanZ3LndZ3NanG4UrdZ3NeocSAV359SCO5176AclMAcnMSnogGDnmVMedORF14Gra-orf22Fig. 3. Phylogenetic trees showing the relatedness of different hexose-epimerases to probable LndZ1 protein (A) and hexose-reductases – to LndZ3 (B). Functions of LanZ1, UrdZ1, TylCVII, Gra-orf25, LanZ3, UrdZ3, NanG4, DnmV, SnoG are given above in the text. Other proteins: CouW – involved in coumermycin biosynthesis in S. rishiriensis, NovW – novobiocin  production in S. spheroides,  MydH - macrolide mycinamicin biosynthesis  in Micromonospora griseoru-bida,  RmlC – deoxysugar biosynthesis in B. tuberculosis, DnmU – daunorubicin production in S.peucetius, Orf4 – anthracycline biosynthesis in S. griseus, AveBV – deoxysugar biosynthesis in S.avermitilis, Neoc - enediyne neocarzinostatin production by S.carzinostaticus, SAV359 - putative hexose-reductase from S.avermitilis, SCO5176 -  putative hexose-reductase from S.coelicolor , AclM, AcnM – sugar biosynthesis during aclacinomycin production in S.galilaeus, MedORF14 – medermycin  biosynthesic in S. sp. AM-7161 , Gra-orf22 – granaticin biosynthesis in S.violaceoruber. A B 96 I. Kozarevska, B. Ostash, M. Samborskyy, V. Fedorenko  porus  1912 lnd cluster leading to removal of lanZ2 and lanGT3 homologues. Latter genes are thought to be responsible for LaE conversion into LaA molecule in S.cyanogenus S136 [14]. Therefore, deletion of lanZ2 and lanGT3 counterparts from lnd cluster accounts for LaE pro-duction phenotype of S. globisporus 1912.      Sequencing of lndZ1 and lndZ3 genes set first stage for detailed investigations on bio-synthesis of LaE deoxysugar moieties We also revealed differences in genetic organization of lnd and lan clusters which correlate with differences in LaE and LaA structures.  OOCH3OHONDPOlndQOCH3ONDPONDP-4-keto-2,6dideoxy-D-glucoseNDP-D-cineluroseONDPCH3NDP-L-cineruloseOONDPOHCH3NDP-L-rhodinoselndZ3lndZ1 lndROOHOHONDPNDP-D-olivoselndGT1,lndGT2OFig. 4. Putative sequence of reactions during L-rhodinose and D-olivose biosynthesis from common precursor NDP-4-keto-2,6-dideoxy-D-glucose.                                                                                                                   stop lndZ1                *       540         *       560         *       580             con : CCTCGCTGGCGGCCACCCTCGCCTCCGGAGTCCTGGCTCCGTGCGCCGCCTGACCGGCACCCGG :   585           start lndZ3                                                                                  *       600         *       620         *       640         *        con : GTGGTGGTCCTGGGCGGCAGCGGCTTCCTCGGCCGGCACCTGCGCACCGCCTACCGGCGTCCGGG :  650 Fig. 5. Fragment of lndZ1 and lndZ3 sequences with intergenic region.  BIOSYNTHESIS OF LANDOMYCIN E ... 97  This work was supported by grant BG-117b from Ministry of Education and Science of Ukraine (to V.F).  We are gratefull to the staff of DNA sequencing facility at the Dept. of Bio-chemistry of Cambridge University (John Lester, Tania Mironenko, Tania Scott) for help in sequencing.     ___________________  1. Fedorenko V., Basiliya L., Pankevych .K. et al. Genetic control of polyketide biosynthesis by actinomycetes-producers of antitumor antibiotics // Bull. Ins. Agr. Micr. 2000. Vol. 2. P. 27-31. 2. Henkel T., Rohr J., Beale J., Schwenen L. Landomycins, new angucycline antibiotics from Streptomyces sp. Structural studies on landomycinsA-D // J. Antibiot. 1990. Vol. 43. P. 492-503.  3. Krohn K., Rohr J. Angucyclines: total syntheses, new structures and biosynthetic stud-ies of an emerging new class of antibiotics // Topics In Curr. Chem. 1997. Vol. 188. P. 127-195.   4. Ostash B. O., Fedorenko V. O. Generation of novel polyketide antibiotics producers with methods of genetic engineering // Biopol. and Cell. 2002. Vol. 467. P. 467-477.  5. Ostash B., Rebets Yu., Samborskiy M. et al. Sequencing and analysis of putative 3rd–4th ring cyclase gene lndF from Streptomyces globisporus 1912 landomycin E biosynthetic gene cluster // Visn. L’viv Univ. Ser. Biol. 2003. Vol. 32. P. 89-94.  6. Ostash B., Rebets Yu., Yuskevich V. et al. Targeted disruption of Streptomyces globisporus 1912 lndF and lndL cyclase genes involved in antitumor landomycin E biosynthesis // Folia Microbiologica. 2003. Vol. 48. P. 512-517.  7. Ostash B., Rix U., Remsing Rix L. et al. Generation of new landomycins by combinatorial biosynthetic manipulation of the lndGT4 gene of the landomycin E cluster in S. globis-porus // Chem. Biol. 2004. Vol. 11. P. 547-555.  8. Rawlings B. Biosynthesis of polyketides // Nat. Prod. Rep. 1999. Vol. 2. P. 425-484.   9. Rebets Y., Ostash B., Luzhetskyy A. et al. Production of landomycins in strains Streptomy-ces globisporus 1912 and S. cyanogenus S136 is regulated by genes encoding putative transcriptional activators // FEMS Microbiol. Lett. 2003. Vol. 222. P. 149-153. 10. Salas J. A., Mendez C. Genetic manipulation of antitumor-agent biosynthesis to produce novel drugs // TIBTECH. 1998. Vol. 161. P. 475-482. 11. Studholme D. J, Bentley S. D, Kormanec J. Bioinformatic identification of novel regu-latory DNA sequence motifs in Streptomyces coelicolor // BMC Microbiol. 2004. Vol. 4. P. 14. 12. Thorson J., Hosted T., Jiang J. et al. Nature’s carbohydrate chemists: the enzymatic glyco-sylation of bioactive bacterial metabolites // Curr. Org. Chem. 2001. Vol. 5. P. 139-167. 13. von Mulert U., Luzhetskyy A., Hofmann C. et al. Expression of the landomycin biosyn-thetic gene cluster in a PKS mutant of Streptomyces fradiae is dependent on the coex-pression of a putative transcriptional activator gene // FEMS Microbiol Lett. 2004. Vol. 15. P. 91-97. 14. Westrich L., Domann S., Faust B. et al. Cloning and characterization of a gene cluster from Streptomyces cyanogenus S136 probably involved in landomycinA biosynthesis // FEMS Microbiol. Lett. 1999. Vol. 170. P. 381-387.  98 I. Kozarevska, B. Ostash, M. Samborskyy, V. Fedorenko   БІОСИНТЕЗ ДЕЗОКСИЦУКРОВОЇ ЧАСТИНИ ЛАНДОМІЦИНУ Е В STREPTOMYCES GLOBISPORUS 1912: СЕКВЕНУВАННЯ ТА АНАЛІЗ ГЕНІВ LNDZ1 ТА LNDZ3  І. Козаревська, Б. Осташ, М. Самборський, В. Федоренко Львівський національний університет імені Івана Франка вул. Грушевського, 4, Львів, 79005, Україна e-mail: v_fedorenko@franko.lviv.ua Визначено нуклеотидну послідовність фрагмента lnd-кластера S. globisporus 1912 розміром 1,5 т.п.н. та виявлено дві відкриті рамки зчитування. Ймовірним продуктом гена lndZ1 є NDP-гексозо-3,4-епімераза, а lndZ3 - NDP-гексозо-4-кеторедуктаза. Припускають, що кодовані ними білки задіяні у каталізі двох останніх етапів формування дезоксицукру L-родинози, яка є в складі молекули ландоміцину Е.  Ключові слова: Streptomyces, ангуцикліни, біосинтез L-родинози, ландоміцин Е. Стаття надійшла до редколегії 06.07.2004 Прийнята до друку 06.09.2004 

Biosynthesis of landomycin E deoxysugar part in Streptomyces globisporus 1912: sequencing and analysis of lndZ1 and lndZ3 genes

https://www.repository.cam.ac.uk/bitstream/1810/296693/1/Samborskyy_Lviv_2004_LndZ.pdf

Biosynthesis of landomycin E deoxysugar part in Streptomyces globisporus 1912: sequencing and analysis of lndZ1 and lndZ3 genes

Abstract

Similar works

Full text

Available Versions

Apollo (Cambridge)