The genomes of RNA viruses often carry conserved RNA structures that perform vital functions during the life cycle of the virus. Such structures can be detected using a combination of structure prediction and co-variation analysis. Here we present results from pilot studies on a variety of viral families performed during bioinformatics computer lab courses in past years

Hofacker, I. L.

Stadler, P. F.

Stocsits, R.R.

Qucosa - Publikationsserver der Universität Leipzig

Conserved RNA Secondary Structures in Viral Genomes:A SurveyIvo L. Hofacker1, Peter F. Stadler1,2, Roman Stocsits11Institut fu¨r Theoretische Chemie und Molekulare Strukturbiologie Universita¨t Wien,Wa¨hringerstraße 17, A-1090 Wien, AustriaPhone: ++43 1 4277 52738; Fax: ++43 1 4277 52793;Email: ivo@tbi.univie.ac.at.2Bioinformatik, Institut fu¨r Informatik, Universita¨t Leipzig, Kreuzstraße 7b, D-04103Leipzig, GermanyThe genomes of RNA viruses often carry conserved RNA structures that perform vitalfunctions during the life cycle of the virus. Such structures can be detected usinga combination of structure prediction and co-variation analysis. Here we presentresults from pilot studies on a variety of viral families performed during bioinformaticscomputer lab courses in past years.1. IntroductionIn addition to coding for proteins, the genomes of RNA viruses often contain functionally activeRNA structures that are vital during the various stages of the viral life cycle. In many cases onlya small part of the viral genome is functionally relevant at the level of RNA. Detecting thesemotifs is a difficult and tedious task since the secondary structures of such regions in general donot look significantly different from structures formed by random sequences.RNA secondary structures are however very fragile to accumulation of point mutations: computersimulations [11] showed that a small number of point mutations is very likely to cause largechanges in the secondary structures: mutations in some 10% of the sequence positions alreadylead almost certainly to unrelated structures if the mutated positions are chosen randomly.Secondary structure elements that are consistently present in a group of sequences with less than,say 95%, average pairwise identity are therefore most likely the result of stabilizing selection,not a consequence of the high degree of sequence conservation.This fact is exploited by the alidot algorithm for a systematic search of conserved secondarystructure patterns in large RNA. In brief, independent predictions of the secondary structurefor each of the sequences and a multiple sequence alignment that is obtained without anyreference to the predicted secondary structures are combined to a list of homologous basepairs. This list is then sorted by means of hierarchical credibility criteria that explicitly takeboth thermodynamic information and information on sequence covariation into account. Adetailed description of the method can be found in [6, 7], the programs are available fromhttp://www.tbi.univie.ac.at/RNA/ as part of the Vienna RNA Package.Detailed analysis of the genomic secondary features are available for picornaviridae [16], fla-viviridae [14], hepadnaviridae [13, 8]. In this contribution we report on preliminary surveys of avariety of virus families.A compilation of conserved cis-acting sequences curated by Henry V. Huang can be found athttp://www.microbiology.wustl.edu/dept/fac/huang/ccas/.1Viral RNA Structures 20 100 200 300 400 500 600 700 800 900 1000110012001300140015001600170018001900200021002200230024002500260027002800290030003100320033003400350036003700C F HDE GBA ICoatAdsorption A2 PolymeraseGGGCA C CCCCCU U CGGGGGGUCclustal code2alnA — 1-150B 80-110 80-110C 540-575 545-615D 1480-1495 1427-1451E 1520-1590 1560-1640F 1785-1855 —G — 2250-2310H 3405-3435 3470-3540I — 3690-3717Figure 1. The Hogeweg mountain plot on the l.h.s. gives an overview of the potentially conservedsecondary structures of the complete RNA genome of Levivirus. The underlying alignment isobtained using code2aln [12]. In the genome chart below credible RNA structures and positions ofthe open reading frames are indicated. Position numbers of these elements (compiled in the smalltable on the r.h.s., refer to the alignment available at http://rna.tbi.univie.ac.at/virus/.The 5’-end structure A is homologous to the 5’-terminal RNA replicase recognition site of theallolevivirus Qβ where it is required for the recognition of the template and its amplification.Element F could correspond to the coat protein binding site that is located just upstream of thepolymerase gene in Qβ.2. LeviviridaeLeviviridae are small ssRNA phages without envelop and tail. The replication cycle includesno DNA stage. The total genome length is 3466 up to 4276 nucleotides depending on typeof strain. Most Levivirus species have four (partly) overlapping genes, some exceptions existwhich contain only three open reading frames. Currently, two structural virion proteins havebeen found and identified.We have investigated 8 sequences of the Levivirus genus. Currently, there are 5 types of strainsrepresented in the GenBank data base as complete genomes: The Enterobacteria phages MS2,KU1, GA, fr, and AP205. The last one was eliminated from the data set analyzed here becauseof large changes in genomic structure.At the 5’-terminal end of the Levivirus sequences we detect a short GC-rich hairpin (tetraloop)which follows to an unpaired GGG element, see Figure 1. This is probably the analogon to therecognition signal site for the RNA replicase in Alloleviviruses, a stem-loop-structure that is wellknown and defined in Qβ. The Qβ replicase amplifies RNA templates autocatalytically with highefficiency. This recognition element, consisting of a hairpin and a very short unpaired region, atthe 5’-terminus, is essential for function [1].Viral RNA Structures 3AAAGAACCCUCGAGACUCAAUUGCAAACCGAA A A U U A AGG_C A A U A A A CA A G AG A A G A C U AA A A AC U U U A A C AA A A CA A U A AUACA A G G GAA AUU A A C U C CUC A A CAAU A C U G U GA A U UAUUCUCUCUACAAAAACAUUGGGGGCACCCAAUUUUACACAGUGAGAAAGCFigure 2. Common RNA structure of Reston Ebola and Marburgvirus in the region from 13100-13270 of their clustalw alignment. The signal was detected by qrna then re-analyzed using alidot.Circles mark sequence variation supporting the structure.3. Negative-Stranded RNA VirusesThe latest version of the Virus Taxonomy [2] classifies the families Paramyxoviridae, Rhab-doviridae, Filoviridae, and Bornaviridae as members of the order Mononegavirales. The familiesOrthomyxoviridae, Bunyaviridae and Arenaviridae remain unassigned.Paramyxoviridae have genome sizes of about 15-16kb. The only unambiguous RNA structureis a panhandle structure that is highly conserved. In a addition, there are few weak signals forspecific small RNA features in the genera Respirovirus and Morbillivirus that deserve a moredetailed analysis.Rhabdoviridae have a genome size of about 12kb. No unambiguous signals have been detected.In the genus rhabdovirus conserved gene-end and start sequences have been reported [15] whichmight be associated also with conserved structural features.Filoviridae. Complete sequences are available only for Reston and Zaire Ebola and for theMarburg virus. These three sequences are insufficient for the alidot approach. The programqrna [10] was therefore used to identify possible conserved RNA features in a pairwise alignment.An example is shown in Fig. 2.Bunyaviridae exhibit panhandle structures that are confirmed by the existence of compensatorymutations. Neither the genus Hantavirus nor the genus Bunyavirus (which has a genome con-sisting of three distinct chromosomes) exhibit convincing additional RNA secondary structuremotifs in either the (+) or the (−)-strand although there are some small hairpins containing afew consistent and compensatory mutations are reported in [5].Orthomyxoviridae have genomes that contain a moderate number of small segments (8 in thecase of the influenza virus) of small segments. As for most negative stranded RNA viruses ourcomputations confirm the well-known panhandle structures [3]. A hairpin loop structure at boththe 5’ and the 3’ end (that competes with the panhandle and hence does not show in our data)is required for efficient endonuclease activity of influenza virus RNA polymerase, an activity thatis required for the cap-snatching activity of primers from host pre-mRNA [9].Arenaviridae also exhibit panhandle structures that have been repeatedly reported in the litera-ture. Conserved intergenic regions containing poly-U stretches are reminiscent of Rhabdoviridae.We did not find evidence that these sequences form conserved secondary structures.Panhandle structures appear to be the only common RNA secondary structure features of neg-ative stranded RNA viruses despite at least weak indications for additional conserved featuresin some groups.4. Positive-Stranded RNA VirusesThe survey of positive-stranded RNA Viruses is far from complete at this point. Apart from thefamilies picornaviridae [16] and flaviviridae [14] which have been studied in detail, preliminarydata are available for three additional unrelated groups.Viral RNA Structures 4Dicistroviridae are an only recently described family of arthodpod viruses. The genome containsa 5’-untranslated region of 500-800nt followed by two ORFs of around 5500nt and 2600ntseparated by an untranslated intergenic region (IGR) of approximately 190nt. This di-cistronicstructure of the genome is special among RNA viruses. The IGR between the replicase andthe four capsid proteins contains an IRES region while the 5’-end contains another IRES motifdespite the fact that translation is fMet initiated. Preliminary data indicate that the IGR-IRESis structurally well conserved.Comoviridae A number of conserved elements with a larger number of compensatory mutationscan be found within the three genera Comovirus, Fabavirus, and Nepovirus. A hairpin structurewith a well-conserved stem and a relatively large A/U-rich loop region (pos 1257-1271 of thenepovirus alignment) is reminiscent of the cis-acting replication element (CRE) of picornaviridae.The close similarity in the life cycle of picornaviridae and comoviridae lends credibility to thisconjecture.Potyviridae have genomes of almost 10000nt consisting of a single ORF, coding for a polypro-tein, and short UTRs at the 5’ and 3’ ends. A number of interesting features were found,especially the 3’UTR seems to contain several well-conserved structures.5. RetroviridaeRetroviridae, in contrast, exhibit a large number of functional RNA secondary structures. Inthe case of the lentivirus HIV some of them are very well characterized both experimentally andcomputationally, such as the TAR hairpin at the 5’ end, the gag/pol frameshift hairpin (alsopresent in Mammalian Type B Retrovirus) and the RRE structure.Our pilot study yield indications for functional RNA structures throughout the family. Thereseems to be little similarity in the motifs used by different genera, however. A comparisonbetween different genera is difficult because the low sequence homology does not permit reli-able alignments. A much more detailed analysis will be necessary to determine whether somesecondary motifs are shared between all Retroviridae.6. DiscussionBy combining thermodynamic structure prediction with co-variation analysis conserved RNAsecondary structures in viral RNA genomes can be reliably detected. The analysis works bestif at least 5 sequences with pairwise identities of around 80% are available. For many typesof viruses such sequence data are now available, and we have begun a systematic survey ofviral RNA structures, the results of which are made available in an on-line database at http://rna.tbi.univie.ac.at/virus/.All RNA viruses studied so far contain at least some functional RNA structures. These conservedstructures occur particularly often in the 5’- and 3’-UTRs, but even within coding regionsconserved structures are not rare.To our surprise, the bibliographic search for experimental evidence of and further informationon “RNA secondary structures” in a given group of virus — a seemingly rather straightforwardtask — turned out to be more tedious than the work on the actual sequence and structure data.We have therefore developed the litsift tool [4] to make bibliographic search in context ofthe Atlas of Viral Secondary Structures more effective. To this end we use classifiers trainedon sample corpora in a system that filters and ranks search results from bibliographic databasessuch as Pubmed. Preliminary results indicate that a classifier trained on one virus group canindeed be applied successfully to search the literature on other virus groups.Viral RNA Structures 5Acknowledgments. This work is supported by the Austrian Fonds zur Fo¨rderung der Wissenschaftlichen Forschung, ProjectNos. P-13545-MAT and P-15893, and the German DFG Bioinformatics Initiative. Pilot studies on individual virus groupswere conducted as part of bioinformatics computer lab courses in Vienna and Leipzig: Winter 2000: Leviviridae (Erwin Gaub-itzer, Philipp Hohensinner); Winter 2001: Retroviridae (Peter Andorfer, Veronika Bayer, Alexander Biedermann, MatthiasBinder, Claudia Blaukopf, Ulrich Braunschweig, Claudia Fried, Stefan Fringer, Sebastian Glatt, David Grote, MichaelaGruber, Jakob Haglmu¨ller, Leonhard Heinz, Astrid Hrdina, Alexander Kassler, Vedhu Krystufek, Christian Lahsnig, BeateLichtenberger, Christian Martschitsch, Georg Mitterer, Michael Mu¨ller, Gregor Obernosterer, Florian Pauler, Paul Perco,Thomas Perlot, Sonja Prohaska, Markus Reschke, Miriam Satler, Manfred Schifrer, Yvonne Schindlegger, Ulrike Seifert,Sabine Stampfl, Stefanie Strobach, Andrea Tanzer, Thomas Taylor, Siegfried Ussar, Stefan Washietl, Wolfgang Winkler);Winter 2002: Mononegalovirales (Philipp Adaktylos, Katja Balazs, Florian Baumgart, Stefan Bruckner, Christoph Buch-mann, Valerie Diederichs, Karin Ebner, Jo¨rg Ettenauer, Wolfgang Fischl, Andrea Fo¨rster, Andreas Gruber, Susanne Haider,Philipp Hainzl, Jennifer Hetzl, Hans-Peter Kantner, Martina Knapp, Stefan Kraus, Roman Ferdinand Kreindl, DominikMuggenhumer, Murat O¨zcelik, Ju¨rgen Pfatschbacher, Petra Pokorny, Josef Ruppert, Johann Schmidt, Simone Schop-per, Andreas Verhounig, Michael Wittinger) Spring 2003: Dicistroviridae (Christine Ko¨rner, Torsten Glomb); Potyviridae(Franziska Heinze, Sonja Karam, Jo¨rg Lehmann, Markus Rohrschneider); Comoviridae (Jan Buck, Alexander Groß, JanaHertel, Manuela Lindemeter, Peter Menzel, Alexander Schubert, Stefan Seemann).References[1] C. K. Biebricher and R. Luce. Sequence analysis of RNA species synthesized by Qbeta replicasewithout template. Biochemistry, 32:4848–4854, 1993.[2] C. Bu¨chen-Osmond. The universal virus database ICTVdB. Computing Science Eng., 5:16–25,2003.[3] H.-K. Cheong, C. Cheong, Y.-S. Lee, B. L. Seong, and B.-S. Choi. Structure of influenza viruspanhandle RNA studied by NMR spectroscopy and molecular modeling. Nucl. Acids Res., 27:1392–1397, 2003.[4] L. C. Faulstich, P. F. Stadler, C. Thurner, and C. Witwer. litsift: Automated text categorizationin bibliographic search. In Data Mining and Text Mining for Bioinformatics (ECML/PKDD 2003),2003. submitted.[5] M. Fekete. Scanning RNA Virus Genomes for Functional Secondary Structures. PhD thesis, Uni-versity of Vienna, 2000.[6] I. L. Hofacker, M. Fekete, C. Flamm, M. A. Huynen, S. Rauscher, P. E. Stolorz, and P. F. Stadler.Automatic detection of conserved RNA structure elements in complete RNA virus genomes. Nucl.Acids Res., 26:3825–3836, 1998.[7] I. L. Hofacker and P. F. Stadler. Automatic detection of conserved base pairing patterns in RNAvirus genomes. Comp. & Chem., 23:401–414, 1999.[8] K. Kidd-Ljunggren, M. Zuker, I. L. Hofacker, and A. H. Kidd. The hepatitis B virus pregenome:prediction of RNA structure and implications for the emergence of deletions. Intervirology, 43:154–64, 2000.[9] M. B. Leahy, H. C. Dobbyn, and e. G. GBrownlee. Hairpin loop structure in the 3’ arm of theinfluenza A virus virion RNA promoter is required for endonuclease activity. J. Virology, 75:7042–7049, 2001.[10] E. Rivas and S. R. Eddy. Noncoding RNA gene detection using comparative sequence analysis. BMCBioinformatics, 2(8):19 pages, 2001.[11] P. Schuster, W. Fontana, P. F. Stadler, and I. L. Hofacker. From sequences to shapes and back: Acase study in RNA secondary structures. Proc. Royal Soc. London B, 255:279–284, 1994.[12] R. Stocsits. Nucleic Acid Sequence Alignments of Partly Coding Regions. PhD thesis, University ofVienna, 2003.[13] R. Stocsits, I. L. Hofacker, and P. F. Stadler. Conserved secondary structures in hepatitis B virusRNA. In Computer Science in Biology, pages 73–79, Bielefeld, D, 1999. Univ. Bielefeld. Proceedingsof the GCB’99, Hannover, D.[14] C. Thurner, C. Witwer, I. Hofacker, and P. F. Stadler. Conserved RNA secondary structures inFlaviviridae genomes. J. Gen. Virol., 2003. submitted.[15] G. Wertz, S. Whelan, A. LeGrone, and B. L.A. Extent of terminal complementarity modulates thebalance between transcription and replication of vesicular stomatitis virus rna. Proc. Natl. Acad.Sci. USA, 91:8587–8591, 1994.[16] C. Witwer, S. Rauscher, I. L. Hofacker, and P. F. Stadler. Conserved RNA secondary structures inpicornaviridae genomes. Nucl. Acids Res., 29:5079–5089, 2001.

Conserved RNA secondary structures in viral genomes: a survey

http://ul.qucosa.de/api/qucosa%3A32113/attachment/ATT-0/

Conserved RNA secondary structures in viral genomes: a survey

Abstract

Similar works

Full text

Available Versions

Qucosa - Publikationsserver der Universität Leipzig