Dumonceaux, T.

Hobson, K.

Olivier, C.

Prager, S.

Pusz-Bochenska, K.

Svendsen, E.

Wist, T.

eCommons@USASK

The origins of aster leafhoppers to the western Canadian prairies

University of Saskatchewan Research Archive

University of SaskatchewanHARVEST, https://harvest.usask.ca/College of Agriculture and Bioresources Soils and Crops Workshop2019-03-05The origins of aster leafhoppers to thewestern Canadian prairiesPusz-Bochenska, K.http://hdl.handle.net/10388/12032Downloaded from HARVEST, University of Saskatchewan's Repository for ResearchKarolina Pusz-Bochenska, Tyler Wist, Tim Dumonceaux, Erl Svendsen, Sean Prager, Chrystel Olivier, Keith Hobson Agriculture and Agri-Food CanadaSaskatoon Research and Development CentreMy PhD project:An early warning system to predict aster yellows outbreaks in Western Canada: origin and arrival of migrant leafhoppers.• caused by the nonculturable, Gram-positive bacteriumAster yellows diseasePhoto, INRA-Dijon0.5 m‘Candidatus Phytoplasma’ spp.• The aster leafhopper Macrosteles quadrilineatus is the main vector of the AY phytoplasma.• Symptoms: Phyllody can lead to verysmall malformed seeds or no seeds at all.In 2012 in SK loss was estimated at around $270 million.• AY infects over 300 species of plants, including:canola, barley, and the pulses.(Tyler Wist)Tyler Wist• Evaluate the origin of migrant aster leafhoppers to better understand    AY risk each year.1. Wind trajectories monitoring. 2. Genetic profiling of leafhoppers sampled in SK and from Southern populations.3. Stable isotopes.Project objectives:>KPB2_LCO_MP8014_19 KPB2-SK3k6-Aberdeen_CO1.0.2 atgtgatcgttacatcccacgcatttattataattttctttatagttataccaattataattgggggttttggtaattgactacttccacttataattggagctcctgatatagcattcccacgactaaataatataagattctgacttctccccccttcattaacactattaatattaagatcaatagtagaaatgggggtagggacgggttgaacagtatacccccccctatctagaaatatcgcacatgcgggcccaagagttgatatatcaattttttctttacatttagccggta• South Wind: Reverse Trajectories• Prairie Pest Monitoring Network (PPMN) monitors winds• Environment CanadaOwen Olfert1, Ross Weiss1, Meghan Vankosky1 and Serge Trudel21 - AAFC2 - ECCCAster Yellows predictions• 2018, May 9th -16th 1st arrival of aster leafhoppers (Southern Sask)• 2018, May 23rd 2nd arrival. Southern and Northern coverageRT wind from Washington020406080100May 1-9 May 9-16 May 16-23Total  adult aster leafhoppersMooseJaw SK 2018 Yellow Sticky Cards n=4/weekGenetic markers to ID popns of aster leafhoppers: CO1 and NADH1Le Roux and Rubinoff2009 createdGenBank recordsSask leafhoppers from 2018Le Roux and Rubinoff 2009• little sequence variation in regions tested•Next: look for SNPs across the genome (Illumina)Project objectives:• Create a fast, diagnostic tool to determine if leafhoppers are infected with AY.Aster yellows detection:• Molecular diagnostics1. DNA extraction2. Molecular detectionRapid AY diagnostics (RAYD)Starring Rebecca Green working out of Tim Dumonceaux’s labMolecular diagnostic assaysDetection and  quantification of phytoplasma• “Nested” PCR• PCR (conventional)• qPCR• ddPCR• LAMP1.2 kb“nested” PCR based on 16S rRNA-encoding locus (F2nR2)Target sequenceP1P71.8 kb2nd PCR tubeR16F2nR16R22nd ampliconF2nR21200 bp~5hr ~45 minGundersen, D. E., & Lee, I. M. (1996). Ultrasensitive detection of phytoplasmas by nested-PCR assays using two universal primer pairs. Phytopathologia Mediterranea, 35(3), 144-151. doi:10.2307/42685262• second “nested” PCR based on different encoding gene- rp ribosomal protein“Universal” PCR amplification tools targeting cpn60cpn60H279H280~600 bpcpn60 UT PCR product549-567 bp of template-derived sequencePhytoplasma genome AY-canola (Saskatoon, SK)Sequencing results16SrI-A16SrI-Bcpn60 I-Brp I-B1101001000100001000001 100 10000 1000000AY-cpn60 copies detectedAY-cpn60 copies addedAY-cpn60AY-cpn60qPCR targeting cpn60 ddPCRLAMP- rapid molecular test of Aster yellows detection in a single leafhopper.Rapid, non-PCR amplificationLoop-mediated isothermal DNA amplification (LAMP)Time to positive (Tp)Binomial (pos/neg)cpn60-targeted LAMP assay0 1 2 3 4 5 6Mq2 may 10Mq2 may 3Mq2 may 1Mq2 may 7Mq25 May 7Mq25 May1Mq2 May 2Mq25 May 4Mq25 May 8Mq25 May 6Mq25 May 3Mq25 May 5Mq25 May 10Mq2 may 4Mq25 May 9Mq2 may 6Mq2 may 9Mq2 may 8Mq2 may 5AY genomes/insect, log10AY- ddPCR copies per insect- + - -- - - -- - - -- - - -- + + +- + - -- - + +- + + +- + + +- + + +- + + +- - + +- - + ++ + + ++ + + ++ - + ++ - + ++ + + +LAMP= ~ 1-2 hr total time Nested PCR= ~ 1 week total timeTake-home message • quick, cheap, and reliable procedures to detect infected canola>KPB2_LCO_MP8014_19 KPB2-SK3k6-Aberdeen_CO1.0.2 atgtgatcgttacatcccacgcatttattataattttctttatagttataccaattataattgggggttttggtaattgactacttccacttataattggagctcctgatatagcattcccacgactaaataatataagattctgacttctccccccttcattaacactattaatattaagatcaatagtagaaatgggggtagggacgggttgaacagtatacccccccctatctagaaatatcgcacatgcgggcccaagagttgatatatcaattttttctttacatttagccggta+ + =Origin of leafhoppers to Western Canadian Prairies Acknowledgments• Funding from Western Grains Research Foundation • Christine Hammond, Edel Lopez, Dana Leedahl• Owen Olfert1, Ross Weiss1, Meghan Vankosky1 and Serge Trudel21 - AAFC2 - ECCCThank youk.pusz@usask.ca

The origins of aster leafhoppers to the western Canadian prairies

Abstract

Similar works

Full text

Available Versions

eCommons@USASK

University of Saskatchewan Research Archive