A cDNA clone encoding a human ribosomal protein L39 (hRPL39) was isolated through a random cDNA sequencing approach to a cDNA library constructed from a human colon carcinoma cell line of COLO 205. Although levels of hRPL39 mRNA were different in several cell lines including carcinoma cell lines from different tissues, they were shown not to be cell cycle-dependent in a human fibroblast cell line of TIG-1

Itakura, Mitsuo

Otsuka, Satoshi

Saito, Shiro

Tanaka, Masaki

Yoshimoto, Katsuhiko

English

Tokushima University Institutional Repository

ELSEVIER Biochimica et Biophysica Acta 1308 (1996) 119-121 BB Biochi~ic~a et  B iophys ica  A~ta  Short sequence-paper Molecular cloning of a cDNA encoding human ribosomal protein L39 Satoshi Otsuka ,.b Masaki Tanaka a.c Shiro Saito b, Katsuhiko Yoshimoto a Mitsuo Itakura a,* Otsuka Department of Clinical and Molecular Nutrition, The Unit,ersiO' of Tokushima, Tokushima 770, Japan b First Department of Internal Medicine, The UnicersiO" of Tokushima, Tokushima 770, Japan c Second Department of Surgery, School of Medicine, The UniversiO' of Tokushima, Tokushima 770. Japan Received 4March 1996; revised 2May 1996; accepted 5 May 1996 Abstract A cDNA clone encoding a human ribosomal protein L39 (hRPL39) was isolated through a random cDNA sequencing approach to a cDNA library constructed from a human colon carcinoma cell line of COLO 205. Although levels of hRPL39 mRNA were different in several cell lines including carcinoma cell lines from different issues, they were shown not to be cell cycle-dependent i  a human fibroblast cell line of TIG-1. Keywords: Ribosomal protein L39; Random cDNA sequencing; (Human) Carcinogenesis  thought o occur as a consequence of multistep alterations in genes [1,2]. In addition to muta- tions or deletions of certain genes, secondary molecular changes in carcinomas contribute to their malignant pheno- types to a certain extent. These secondary changes provide us with important information concerning the molecular basis of carcinoma nd may lead us to find markers for the disease or a new therapeutic target. A random cDNA sequencing approach has recently become an effective method to obtain a group of genes expressed in specific states of cells or tissues by generating expressed sequence tags [3-6]. We applied a random cDNA sequencing ap- proach to a human colon carcinoma cell line of COLO 205 [7], and isolated several cDNAs encoding ribosomal pro- teins. Among them, one was found to encode a human homologue of rNRPL39. Cell preparation, cDNA construction, sequencing and analysis of cDNAs, RNA extraction, and Northern blot analysis were performed as previously described [7]. TIG- l  cells (a normal human fibroblast cell line) cultured to subconfluence were synchronized in the quiescent G o state by culturing them in DMEM supplemented with 0.5% Abbreviations: DMEM, Dulbecco's modified Eagle's medium; FCS, fetal calf serum; hRP, human ribosomal protein; rNRP, rattus norvegicus ribosomal protein; GAPDH, glyceraldehyde-3-phosphate dehydrogenase. * Corresponding author. Fax: +81 886 319476; e-mail: itakura@ nutr.med.tokushima-u.ac.jp. The sequence data reported in this paper have been submitted tothe EMBL/GenBank Data Libraries under the accession number D79205. FCS. The medium was changed on days 2 and 4. On day 6, the medium was changed to DMEM with 10% FCS to stimulate their growth [8]. Total RNA of TIG-1 was ex- tracted by the acid guanidium thiocyanate-phenol-chloro- form method [9] at 0, 6, 12, 18, and 24 h after growth stimulation and used for Northern blot analysis. Quantifi- cation of Northern blot analysis was performed by Fujix BAS 2000 phosphorimaging plates and a phosphorimager (Fuji, Tokyo, Japan) with the quantities tandardized for the GAPDH message as a control. We randomly picked up 1056 cDNA clones from the cDNA library constructed from COLO 205 and sequenced them by a single path sequencing [7]. The obtained se- quences were compared with each other at first to assess the frequency of their appearance in our library, and then with the DNA data base in GenBank using a FASTA program [10,11]. Out of 526 independent cDNA species, we obtained 45 species encoding partial sequences of ribosomal proteins with frequencies of appearance in the library ranging from one to nine times. Of these 45 independent cDNA species, 22 were found only once, and the clone we report here was one of them. While analyzing the sequences of the cDNA clones, we came across a cDNA which was not identified in humans before and is highly homologous to rNRPL39. Only the partial sequences were found in the DNA databases with the accession numbers L05096 and D28397 [12,13]. The nucleotide sequence determined by sequencing both strands of the cDNA three times and the deduced amino acid sequence are shown in Fig. 1. The cDNA included 37 0167-4781/96/$15.00 Copyright © 1996 Elsevier Science B.V. All rights reserved. PII SO 167-478 I (96)00 106-6 120 S. Otsuka et al. / Biochimica et Biophysica Acta 1308 (1996) 119-121 i0 20 30 40 50 60 CAGCCATCGTGGTGTGTTCTTGACTCCGCTGCTCGCCATGTCTTCTCACAAGACTTTCAG M S S H K T F R 70 80 90 I00 I I0 120 GATTAAGCGA TTCC TGGC CAAGAAACAAAAGCAAAATCGTC C ATTC C C CAGTGGATTC G I K R F L A K K Q K Q N R P I P Q W I R 130 140 150 160 170 180 GATGAAAACTGGAAATAAAATCAGGTACAAC TCCAAAAG GAGACATTGGAGAAGAACCAA M K T G N K I R Y N S K R R H W R R T K 190 200 210 220 230 240 GC TGGGTC TATAAGGAATTGCACATGAGAT~C ACATATTTAT GC TGTCTGAAGGTCA L G L * 250 260 270 280 290 300 C GAT CATGTTACCATATCAAGCTGAAAATGTCAC CAC TATC TGGAGATTTC GACGTGTTT 310 320 330 340 350 360 TCCT C TCTGAATCTGTTATGAAC ACGTTGGTTGGC TGGATTC AGTAATAAATATGTAAGG 370 CC~C'I"I"I"I"i' Fig. l. The full length nucleotide sequence of hRPL39 and its deduced amino acid sequence. The numbered positions of nucleotides are indi- cated above the sequence and the polyadenylation signal is underlined. 5'-non-coding nucleotides, an open reading frame of 153 nucleotides, and 181 nucleotides in the 3'-untranslated region, followed by a poly(A) tail. The polyadenylation signal, AATAAA,  was located at nucleotides 346 to 351. The open reading frame specified a protein of 51 amino acids with the theoretical molecular weight of 7307. The nucleotide sequence of the eDNA shared 90.8% similarity (14 different nucleotides out of 181 nucleotides) within the coding region (Fig. 2A), and its deduced amino acid sequence shared 100% similarity with that of rNRPL39 (Fig. 2B). These results identified this eDNA as that for hRPL39. We examined the levels of hRPL39 mRNA among different organs by Northern blot analysis (Fig. 3A). The signals were observed by cross-hybridization f an hRPL39 eDNA probe with mRNAs in organs of mice due to difficulty to obtain human tissues. RPL39 was ubiquitously expressed in all organs we examined. Lung and spleen showed about two-fold increased amounts of RPL39 mRNA when compared with those in other organs. Because ribosomal proteins were reported to be overex- pressed in carcinoma ceils and tissues [14-21], the levels of hRPL39 mRNA were examined in cultured human cell lines. Fig. 3B shows a representative Northern blot analy- (A) ATGTCTTC TCACAAGACTTTCAGGATTAAGCGATTCCTGGC C AAGAA CAAAAC-CAAAAT ***********************  ** **************  ******************  ATGTC TTC TCACAAGACTTTCAGAATC AAGCGATTC CTGGC AAAGAAACAAAAGCAAAAT C GTC CCATTC C CCAGTGGATTCGGATGAAAAC TGGAAATAAAATCAGGTACAACTCCAAA *****  ***** ** ********************  ** *****************  ** C GTC CTATTCC TCAATGGATTC GGATGAAAAC TGGTAACAAAATCAGGTACAAC~C TAAG AGGAGACATTGGAGAAGAACCAAGC TGGGTC TA ** ***** ***** ***** ************  AGAAGACAC TG GAGGAGAAC GAAGCTGGGTC TA (B) MS S H KTFRI  KRFLAKKQKQNRP I PQWI  RMKTGNK I RYNS KRRHWRRTKLGL ***************************************************  MS SHKTFRIKRFLAKKQKQNRP I PQWI RMKTGNKIRYNSKRPJ{WRRTKLGL Fig. 2. Comparison of the nucleotides and deduced amino acids of hRPL39 with those of rNRPL39 within the open reading frame. (A) hRPL39 showed 90.8% similarity at the nucleotide sequence and (B) 100% similarity at the amino acid sequence with the rat counterpart. (upper panel, hRPL39; lower panel, rNRPL39). sis of hRPL39 in COLO 205, CW2 (a human colon carcinoma cell line), hNCI-H520 (a human lung squamous carcinoma cell line), and TIG-1. In comparison to hRPL39 mRNA in TIG-1, it was expressed almost at the same level in CW2, about wo-fold higher in COLO 205 and three-fold higher in hNCI-H520, based on the quantitation using a phosphorimager (Fuji) (data not shown). These different expression levels may reflect the origin of tissues from which they were derived, because hNCI-H520 and lung showed a relatively high hRPL39 mRNA expression level. However, the mRNA level of hRPL39 was two-fold higher in COLO 205 than that in CW2, despite that they were derived from the same colonic origin. These altered mRNA levels may reflect different malignant phenotypes of these cells, because the mRNA level of a certain ribosomal protein was reported to correlate with colorectal carcinoma progression and its biological aggressiveness [14]. The mRNA of another human ribosomal protein S13 which was also overexpressed in carcinoma cells, was reported to correlate with the in vitro proliferative rate [15]. In addition, expression of several growth-associated (A) (B) (C) . . . . . . . . .  -28S -IlK~ -18S -18S Fig. 3. Northern blot analysis of hRPL39. (A) RNA samples of brain, heart, lung, liver, spleen, kidney, and intestine which were abbreviated as Br, He, Lu, Li, Sp, Ki, and In, respectively, were extracted from C57BL/6 mice. Twelve micrograms each of total RNA were cross-hybridized with an hRPL39 cDNA probe. (13) Twelve micrograms of total RNA samples from COLO205, CW-2, hNCI-H520, and TIG-I, which were abbreviated asC, W, N, and T, respectively, were hybridized with an hRPL39 eDNA probe. (C) Total RNAs of TIG-1 at 0, 6, 12, 18, and 24 h after growth stimulation were hybridized with an hRPL39 eDNA probe. All blots were rehybridized with a murine GAPDH eDNA probe as a control (lower panel), The positions of 18S and 28S rRNA are indicated. S. Otsuka et al. / Biochimica et Biophysica Acta 1308 (1996) 119-121 121 genes such as c-myc [22], c-myb [23], cyclin, and thymi- dine kinase [24], was reported to be cell cycle-dependent. However, little is known about the relationship between the cell cycle and the expression level of ribosomal pro- teins. Thus, we examined the expression of hRPL39 for its cell cycle-dependency in TIG-1. TIG-1 was used because hRPL39 was expressed at a fairly high level, and because they had been well analyzed for their cell cycles. TIG-I cells were first synchronized to G O phase with serum starvation by 0.5% FCS, and their growth was stimulated by increasing the FCS concentration up to 10% as de- scribed [8]. As shown in Fig. 3C, the hRPL39 mRNA levels standardized for the GAPDH message were not significantly changed in TIG-I (about 1.3-fold at most) during 24 h after the cell growth stimulation, suggesting that hRPL39 mRNA is stably expressed throughout i s cell cycle phases. These results are consistent with the notion that the altered protein synthetic capacity in different growth states is based on changes in translation of riboso- mal protein mRNA, rather than changes in mRNA abun- dance or stability, except for the condition where de- creased mRNA levels were observed associated with dif- ferentiation [25]. It is likely that a subset of ribosomal proteins is overex- pressed to produce other essential proteins to keep up with the high level proliferation and/or maintaining malignant phenotypes in certain carcinomas, because ribosomal pro- teins play an important role in protein synthesis via forma- tion of ribosomal subunits [26]. Careful future studies on the relationship between malignant phenotypes of carcino- mas and expression patterns of ribosomal proteins hould help us to understand the significance of their overexpres- sion in carcinomas, which may afford us therapeutic tar- gets of carcinomas. This work was supported in part by a grant from Otsuka Pharmaceutical Factory Inc. The authors are grateful to M. Iwami, K. Adzuma, S. Hamaguchi, Y. Suganaka, and H. Kimura for their excellent technical assistance. References [1] Feinberg, A.P., Law, D.J., Lefran~ois, D., Delattre, O. and Thomas, G. (1989) Cancer Cells 7, 245-248. [2] Fearon, E.R. and Vogelstein, B. (1990) Cell 61,759-767. [3] Adams, M.D., Kelley, J.M., Gocayne, J.D., Dubnick, M., Poly- meropoulos, M.H., Xiao, H., Merril, C.R., Wu, A., Olde, B., Moreno, R.F., Kerlavage, A.R., McCombie W.R. and Venter, J.C. (199l) Science 252, 1651-1656. [4] Okubo, K., Hori, N., Matoba, R., Niiyama, T., Fukushima, A., Kojima, Y. and Matsubara, K. (1992) Nature Genet. 2, 173-179. [5] Okubo, K., Hori, N., Matoba, R., Niiyama, T. and Matsubara, K. (1992) DNA sequence 2, 137-144. [6] Adams, M.D., Kerlavage, A,R., Fields, C. and Venter, J.C. (1993) Nature Genet. 4, 256-267. [7] Tanaka, M., Adzuma, K., Iwami, M., Yoshimoto, K., Monden, Y. and Itakura, M. (1995) Cancer Lett. 89, 195-200. [8] Ayusawa, D., Shimizu, K., Koyama, H., Kaneda, S., Takeishi, K. and Seno, T. (1986) J. Mol. Biol. 190, 559-567. [9] Xie, W.Q. and Rothblum, L.I. (199l) BioTechniques 11, 324-327. [10] Lipman, D.J. and Pearson, W.R. (1985) Science 227, 1435-1441. [1 l] Pearson, W.R. and Lipman, D.J. (1988) Proc. Natl. Acad. Sci. USA 85, 2444-2448. [12] Bhat, K.S. (1992) GenBank registration. [13] Kato, S., Sekine, S., Oh, S.W., Kim, N,S., Umezawa, Y., Abe, N., Yokoyama-Kobayashi, M. and Aoki, T. (1994) Gene 150 (2), 243- 250. [14] Barnard, G.F., Staniunas, R.J., Bao, S., Mafune, K., Steele, G.D., Jr., Gollan, J.L. and Chen, L.B. (1992) Cancer Res. 52, 3067-3072. [15] Denis, M.G., Chadeneau, C., Lecabellec, M-T., LeMoullac, B., LeMevel, B., Meflah, K. and Lustenberger, P. (1993) Int. J. Cancer 55, 275-280. [16] Elvin, P., Kerr, I.B., McArdle, C.S. and Birnie, G.D. (1988) Br. J. Cancer 57, 36-42. [17] Chester, K.A., Robson, L., Begent, R.H.J., Talbot, I.C., Pringle, J.H., Primrose, L., McPherson, A.J.S., Boxer, G., Southall, P. and Malcolm, A.D.B. (1989) Biochim. Biophys. Acta 1009, 297-300. [18] Sharp, M.G.F., Adams, S.M., Elvin, P., Walker, R.A., Brammar, W.J. and Varley, J.M. (1990) Br. J. Cancer 61, 83-88. [19] Pogue43eile, K., Gieser, J.R., Shu, M., Miller, C., Wool, I.G., Meisler, A.I. and Pipas, J.M. (1991) Mol. Cell. Biol. 11, 3842-3849. [20] Kondoh, N., Schweinfest, C.W., Henderson, K.W. and Papas, T.S. (1992) Cancer Res. 52, 791-796. [21] Barnard, G, F., Staniunas, R.J., Mori, M., Puder, M., Jessup, M.J., Steele, G.D., Jr. and Chen, L.B. (1993) Cancer Res. 53, 4048-4052. [22] Dani, Ch., Mechti, N., Piechaczyk, M., Lebleu, B., Jeanteur, Ph. and Blanchard, J.M. (1985) Proc. Natl. Acad. Sci. USA 82, 4896-4899. [23] Thompson, C.B., Challoner, P.B., Neiman. P.E. and Groudine, M. (1986) Nature 319, 374-380. [24] Jaskulski, D., Gatti, C., Travali, S., Calabretta, B. and Baserga, R. (1988) J. Biol. Chem. 263, 10175-10179. [25] Seshadri, T., Uzman, J.A., Oshima, J. and Campisi, J. (1993) J. Biol. Chem. 268, 18474-18480. [26] Mager, W.H. (1988) Biochim. Biophys. Acta 949, l-15. 

Molecular cloning of a cDNA encoding human ribosomal protein L39

https://repo.lib.tokushima-u.ac.jp/files/public/11/113514/20190723150747119874/bbagse_1308_2_119.pdf

Molecular cloning of a cDNA encoding human ribosomal protein L39

Abstract

Similar works

Full text

Available Versions

Tokushima University Institutional Repository