This work identifies the fragile-X-related protein (FXR1) as a reciprocal regulator of HuR target transcripts in vascular smooth muscle cells (VSMCs). FXR1 was identified as an HuR-interacting protein by liquid chromatography-tandem mass spectrometry (LC-MS/MS). The HuR-FXR1 interaction is abrogated in RNase-treated extracts, indicating that their association is tethered by mRNAs. FXR1 expression is induced in diseased but not normal arteries. siRNA knockdown of FXR1 increases the abundance and stability of inflammatory mRNAs, while overexpression of FXR1 reduces their abundance and stability. Conditioned media from FXR1 siRNA-treated VSMCs enhance activation of naive VSMCs. RNA EMSA and RIP demonstrate that FXR1 interacts with an ARE and an element in the 3′ UTR of TNFα. FXR1 expression is increased in VSMCs challenged with the anti-inflammatory cytokine IL-19, and FXR1 is required for IL-19 reduction of HuR. This suggests that FXR1 is an anti-inflammation responsive, HuR counter-regulatory protein that reduces abundance of pro-inflammatory transcripts

Autieri, Michael V.

Haines, Dale S.

Herman, Allison B.

Kelemen, Sheri E.

Moradian, Annie

Ray, Mitali

Sweredoski, Michael J.

Vrakas, Christine N.

Caltech Authors - Main

Cell Reports, Volume 24Supplemental InformationFXR1 Is an IL-19-Responsive RNA-Binding
Protein that Destabilizes Pro-inﬂammatory
Transcripts in Vascular Smooth Muscle Cells
Allison B. Herman, Christine N. Vrakas, Mitali Ray, Sheri E. Kelemen, Michael J.
Sweredoski, Annie Moradian, Dale S. Haines, and Michael V. Autieri
Figure S1.  Normal tissue controls for Figure 2.  Related to Figure 2. A. unligated normal mouse carotid artery.  B. wild-type
aorta.  C-H matching isotype control antibody for all tissues shown.  
Figure S2. Binding affinities of A. FXR1 and B. HuR for the TNF 3’UTR 50 mer. Related to Figure 6. Increasing concentrations
of GST-fusion protein were incubated with TNF 3’UTR 50 mer and fraction bound was calculated using non-linear fit, site-
specific binding with Hill slope.  
Figure S3. RNA-EMSA cold competition GST-controls. Related to Figure 6. A. Non-biotinylated probes consisting of a 25-mer
of (AUUUA)5, a 27-mer of (UUAUUUAUU)3, a 36- mer of (CUUGUGAUU)4, a 40-mer of (CAGAGAUGAA)4 (40 bases) were 
added to the reaction to compete with the biotinylated TNFprobe, prior to the addition of the biotinylated TNF 50mer, and 
RNA EMSA performed using GST-control and GST-FXR1. The same experimental design was used in B, using GST-control and 
GST-HuR.  
Figure S4. RNA-EMSA cold competition. Related to Figure 6. A. Non-biotinylated probes consisting of a 25-mer of (AUUUA)5,
a 27-mer of (UUAUUUAUU)3, a 36- mer of (CUUGUGAUU)4, a 40-mer of (CAGAGAUGAA)4 (40 bases) were added to the 
reaction to compete with the biotinylated TNFprobe at increasing concentrations of 0.01mM, 10mM, and 1000mM, prior to the 
addition of the biotinylated TNF50mer, and RNA EMSA performed using GST-FXR1. B. Densiometric analysis of percent 
binding of cold probes to GST-FXR1.  C. G quadruplex (GGGG) cold probe was incubated with GST and GST-FXR1 at 
increasing concentrations 0.01mM, 10mM, and 1000mM for 30 minutes prior to the addition of the biotinylated TNF 50-mer 
probe. D. Densiometric analysis of G quadruplex binding to GST-FXR1.  
Protein - + 
% 
occurrence 
Agarose 
% occurrence 
FLAG epitope GO Analysis 
HELZ2 0 50 1.78 1.28 
Poly(A) RNA binding, ligand-dependent nuclear receptor 
transcription coactivator activity 
UPF1 0 45 3.91 8.33 Poly(A) RNA binding 
FAM120A 0 43 8.19 2.56 Poly(A) RNA binding 
EIF461 0 37 N/A N/A RNA binding 
EIF 0 36 N/A N/A RNA binding 
EIF4G1 0 36 16.73 32.05 RNA binding 
LARP1 0 35 16.73 10.26 Poly(A) RNA binding 
ILF3 0 33 33.10 41.67 Poly(A) RNA binding and double-stranded RNA binding 
IGF2BP3 0 27 17.44 19.23 RNA binding, nucleic acid binding 
MOV10 0 26 5.69 5.77 RNA binding, helicase activity 
IGF2BP2 0 24 14.95 16.67 RNA binding, nucleic acid binding 
PABP14 0 24 N/A N/A RNA binding 
RRBP1 0 24 13.17 10.26 Poly(A) RNA binding and receptor activity 
PABC4 0 24 N/A N/A RNA binding 
SYNCRIP 0 23 38.43 53.85 Nucleic acid binding and RNA binding 
PRRC2C 0 23 14.59 8.33 Poly(A) RNA binding and protein C-terminus binding 
OASL 0 20 N/A N/A Poly(A) RNA binding and double-stranded RNA binding 
FAM120C 0 20 N/A N/A Poly(A) RNA binding 
ELAV I 0 18 N/A N/A Nucleic acid binding and RNA binding 
TROVE2 0 18 2.92 2.56 RNA binding and U2 snRNA binding. 
HNRNPU 0 18 58.72 83.97 Poly(A) RNA binding and kinase activity 
DHX9 0 18 40.21 56.41 Nucleic acid binding and helicase activity 
HNRNPA1 0 17 53.38 75.64 Nucleic acid binding and RNA binding 
NUFIP2 0 17 23.49 11.54 Poly(A) RNA binding and RNA binding 
HNRNPK 0 16 56.94 93.59 Nucleic acid binding and RNA binding 
HNRNPL 0 16 42.35 44.87 Nucleic acid binding and RNA binding 
STAU2 0 16 6.41 1.92 Poly(A) RNA binding, double-stranded RNA binding 
STAU1 0 16 12.10 7.69 Poly(A) RNA binding, double-stranded RNA binding 
CCAR2 0 16 21.71 41.03 Poly(A) RNA binding, enzyme inhibitor activity 
DDX3X 0 16 33.10 65.38 nucleic acid binding and RNA binding 
FUBP3 0 16 9.96 8.33 Nucleic acid binding and RNA binding 
DDX5 0 16 50.18 67.95 Nucleic acid binding and enzyme binding 
FLJ94229 0 16 N/A N/A Nucleic acid binding and RNA binding 
DDX3Y 0 15 30.60 61.54 Nucleic acid binding and RNA binding 
RPS9 0 15 32.03 46.79 Poly(A) RNA binding, structural constituent of ribosome 
ATXN2L 0 15 37.72 8.33 Poly(A) RNA binding and structural constituent of ribosome 
CSDA 0 15 N/A N/A 
Nucleic acid binding and transcription factor activity, 
sequence-specific DNA binding 
RPL4 0 14 46.98 41.67 Poly(A) RNA binding and structural constituent of ribosome 
ILF2 0 14 29.89 44.87 Poly(A) RNA binding and double-stranded RNA binding 
HNRNPC 0 14 38.43 33.97 Nucleic acid binding and identical protein binding 
AGO2 0 14 6.05 11.54 Nucleic acid binding and RNA binding 
FXR1 0 13 6.05 6.41 Nucleic acid binding and RNA binding 
ATXN2 0 13 9.61 0.64 Poly(A) RNA binding and protein C-terminus binding 
HNRNPA2B1 0 13 55.16 66.67 Nucleic acid binding and RNA binding 
HNRNPH1 0 12 49.47 89.10 Nucleic acid binding and RNA binding 
HNRNPA3 0 12 39.86 44.87 Nucleic acid binding and RNA binding 
DDX1 0 12 18.86 41.03 Nucleic acid binding and chromatin binding 
MYO5A 0 12 4.27 8.33 Nucleic acid binding and chromatin binding 
EIF4G3 0 12 10.32 5.13 Poly(A) RNA binding and binding 
TRIM25 0 11 7.12 5.13 Poly(A) RNA binding and acid-amino acid ligase activity. 
AGO3 0 11 2.85 5.13 Nucleic acid binding and RNA binding 
PTBP1 0 10 35.94 51.92 Nucleic acid binding and RNA binding 
HNRNPD 0 10 45.91 56.41 Nucleic acid binding and RNA binding 
HNRNPUL2 0 10 11.74 6.41 Poly(A) RNA binding and kinase activity 
HNRNPUL1 0 10 18.86 17.31 Nucleic acid binding and RNA binding 
ZC3HAV1 0 10 14.95 5.77 
Poly(A) RNA binding and NAD+ ADP-ribosyltransferase 
activity 
FLJ58199 0 10 N/A N/A Nucleic acid binding and RNA binding 
Table S1. Complete table of putative HuR-interacting proteins identified by LC-MS/MS ranked in order peptide sequences.
Related to Figure 1. Columns Flag empty-vector (-) and the Flag-immunoprecipitated (+) provide the raw spectral counts from 
VSMCs following IP with anti-Flag antibody. Proteins were identified by LC MS/MS and were included in the table if the spectral 
count was above 10. The additional columns provide the percent occurrence of an identified protein in agarose bead or Flag 
epitope samples found in the Contaminant Repository for Affinity Purification (CRAPome) database. Elav1 was the bait protein 
used to pull-down proteins for LC MS/MS. CRAPome database provided no additional information about Elav1.  
Protein - + 
% occurrence FLAG 
epitope GO Analysis 
ATXN2 0 13 0.64 Poly(A) RNA binding and structural constituent of ribosome 
HELZ2 0 50 1.28 
Poly(A) RNA binding, ligand-dependent nuclear receptor 
transcription coactivator activity 
STAU2 0 16 1.92 Poly(A) RNA binding, double-stranded RNA binding 
FAM120A 0 43 2.56 Poly(A) RNA binding 
TROVE2 0 18 2.56 RNA binding and U2 snRNA binding. 
EIF4G3 0 12 5.13 Poly(A) RNA binding and binding 
TRIM25 0 11 5.13 Poly(A) RNA binding and acid-amino acid ligase activity. 
AGO3 0 11 5.13 Nucleic acid binding and RNA binding 
MOV10 0 26 5.77 RNA binding, helicase activity 
ZC3HAV1 
0 10 
5.77 
Poly(A) RNA binding and NAD+ ADP-ribosyltransferase 
activity 
FXR1 0 13 6.41 Nucleic acid binding and RNA binding 
HNRNPUL2 0 10 6.41 Poly(A) RNA binding and kinase activity 
STAU1 0 16 7.69 Poly(A) RNA binding, double-stranded RNA binding 
UPF1 0 45 8.33 Poly(A) RNA binding 
PRRC2C 0 23 8.33 Poly(A) RNA binding and protein C-terminus binding 
FUBP3 0 16 8.33 Nucleic acid binding and RNA binding 
ATXN2L 0 15 8.33 Poly(A) RNA binding and protein C-terminus binding 
MYO5A 0 12 8.33 Nucleic acid binding and chromatin binding 
ELAV1 0 18 N/A Nucleic acid binding and RNA binding 
Table S2. Putative HuR-interacting proteins identified by LC-MS/MS ranked in order of percent occurrence by FLAG epitope
found in the Contaminant Repository for Affinity Purification (CRAPome) database. Related to Figure 1. Columns Flag empty-
vector (-) and the Flag-immunoprecipitated (+) provide the raw peptide sequences from VSMCs following IP with anti-Flag 
antibody. Proteins were identified by LC MS/MS. *Indicates Elav1 was the bait protein used to pull-down proteins for LC MS/
MS. CRAPome database provided no additional information about Elav1.  
Supplemental Experimental Procedures 
Immunohistochemistry.  Ligated mouse carotid arteries, plaque from LDLR-/- mice, and human coronary 
arteries were collected as part of studies described previously (Ellison et al., 2013, 2014).  Tissue sections 
were fixed in 10% buffered formalin, embedded in paraffin, sectioned at 5 μm, deparaffinized in xylene and 
rehydrated through graded alcohols. Endogenous peroxidase activity was blocked with 1.5% hydrogen 
peroxide in methanol for 15 min. Tissue sections were blocked in 10% goat serum, incubated with primary 
antibody at 0.5 μg/ml in 1%BSA/PBS and were applied for 1 h, followed by incubation with biotinylated 
secondary antibody (1:200), followed by avidin-biotin peroxidase complex each for 30 min. Non-specific 
identical IgG isotype control (Neomarkers # NC-100-P, and Biolegend #400601) antibodies were used as 
negative controls. The reaction product was visualized using DAB (Vector Labs, Burlingame, Ca, USA) as 
the chromogenic substrate, which produces a reddish-brown stain. The sections were counterstained with 
hematoxylin.  Immunofluorescence co-staining on human coronary artery sections was performed as 
described (Autieri et al., 2002; Ellison et al., 2013).  Briefly, anti-SMC actin, (NeoMarkers, Inc, Burlingame, 
CA, USA) and anti-FXR1 antibody was followed by a 30-minute incubation with secondary antibody 
conjugated to AlexaFluor 568 (red) and AlexaFluor 488 (green) (Molecular probes, Inc., Eugene, OR, USA).  
For cellular stress granule staining, human VSMC were grown on glass cover slides and fluorescent stained 
with Anti-PABP antibody (AbCam, Cambridge, UK), Anti-FXR1 antibody (AbCam), were used.  Will need 
to ask Sheri for HuR and DAPI. 
LC-MS/MS.  LC-MS/MS analysis was performed as described previously (Haines et al., 2012).  Briefly, 
VSMC were transduced with recombinant adenovirus expressing FLAG-tagged HuR or empty vector control. 
Pellets were collected and lysed in maltoside based-lysis buffer containing 1 × protease inhibitor tablet 
(Roche) for 30 min on a nutator at 4 °C. The lysates were centrifuged at 16,600 × g for 15 min to remove cell 
debris, and the supernatant was incubated with anti-FLAG beads, followed by 5 washes in lysis buffer. 
Proteins were eluted from beads in 10 M freshly prepared urea. Digestion was performed in 100 mM Tris-
HCl (pH 8.5) containing 8 M urea at 37 °C first with Lys-C (35 ng/mg lysate) for 4 h, and then the urea 
concentration was reduced to 2 M for trypsin (30 ng/mg lysate) digestion overnight. Following digestion, the 
tryptic peptides were desalted on a reversed-phase Vivapure C18 micro spin column (Sartorius Stedim 
Biotech, Gottingen, Germany) and concentrated using a SpeedVac. Dried samples were acidified by 0.2% 
formic acid prior to liquid chromatography-mass spectrometric analysis.  All LC-MS/MS experiments were 
performed on a nanoflow LC system, EASY-nLC II (Thermo Scientific, Waltham, MA, USA) connected to 
a hybrid LTQ Orbitrap Classic (Thermo Scientific, Waltham, MA, USA) equipped with a nano-electrospray 
ion source. For the EASY-nLC II system, solvent A consisted of 97.8% H2O, 2% ACN, and 0.2% formic acid 
and solvent B consisted of 19.8% H2O, 80% ACN, and 0.2% formic acid. Samples were directly loaded onto 
a 16-cm analytical HPLC column (75 mm ID) packed in-house with ReproSil-Pur C18AQ 3 um resin (120A° 
pore size, Dr. Maisch, Ammerbuch, Germany). The column was heated to 45° C. The peptides were separated 
with a 160 min gradient at a flow rate of 350 nL/min. The gradient was as follows: 2–30% Solvent B (150 
min), 30–100% B (1 min), and 100% B (9 min). Eluted peptides were then ionized using a standard coated 
silica tip (New Objective, Woburn, MA, USA) as an electrospray emitter and introduced into the mass 
spectrometer.  The LTQ Orbitrap was operated in a data-dependent mode, automatically alternating between 
a full-scan (m/z 300-1700) in the Orbitrap and subsequent MS/MS scans of the 15 most abundant peaks in the 
linear ion trap (Top15 method). Data acquisition was controlled by Xcalibur 2.0.7 and Tune 2.4 software 
(Thermo Fisher Scientific, Waltham, MA, USA). For data analysis, peaks were generated from raw data files 
using MaxQuant (version 1.5.1.2) with default parameters and searched using the built-in search engine 
Andromeda. Peak lists were searched against the UniProt human database (148298 sequences including 
isoforms) and a contaminant database (262 sequences). Thresholds for peptide and protein scores were chosen 
to have at most a 1% FDR as estimated by a decoy database (Cox and Mann, 2008; Cox et al., 2011). 
RNA Extraction and Quantitative RT-PCR.  VSMCs were serum starved in 0.1% FCS for 48 hours, then 
stimulated with 10 ng/mL TNFα for the indicated times. RNA from cultured VSMCs was isolated and reverse 
transcribed into cDNA, as we have described, and target genes were amplified using an Applied Biosystems 
StepOne Plus Real-Time PCR System as we described (Gabunia et al., 2016, 2017). Multiple mRNAs (CT 
values) were quantitated simultaneously by the Applied Biosystems software. Primer pairs were purchased 
from Integrated DNA Technologies (Coralville, IA, USA), and SYBR Green was used for detection. The 
following primer pairs were used:  
hGAPDH: F: CGAGAGTCAGCCGCATCTT, R: CCCCATGGTGTCTGAGCG,    
hIL-1β: F: TCCCCAGCCCTTTTGTTGA, R: TTAGAACCAAATGTGGCCGTG,  
hICAM1: F: CTCCAATGTGCCAGGCTTG,  R: GAGTGGGAAAGTGCCATCCT 
hFXR1: F: GAGTTACCGCCATTGAGCTAG, R: ACTTTTCCAACGAGATTCCTAGG 
hHuR: F: CCGTCA CAAATGTGAAAGTG,  R: TCGCGGCTTCTTCATAGTTT 
hTNF: F: GGTCTACTTTGGGATCATTGC, R: GAAGAGGTTGAGGGTGTCTG 
hMCP1: F: AGCAGAAGTGGGTTCAGGATT,  R: TGTGGAGTGAGTGTTCAAGTCT 
hPPAR: F: GCTATCATTACGGAGTCCACG, R: TCGCACTTGTCATACACCAG 
hB2M: F: GGCATTCCTGAAGCTGACAG, R: TGGATGACGTGAAACCTG 
 
Transfection, siRNA knockdown and overexpression, and luciferase. Gene silencing was performed using 
ON-TARGET plus SMARTpool FXR1 siRNA, which contains a mixture of four siRNAs which target human 
FXR1 (10 nM) purchased from Dharmacon, Inc. (Lafayette, Co, USA)  as we have described (Cuneo et al., 
2010; Gabunia et al., 2016). Scrambled control siRNA was also purchased from Dharmacon, Inc. Transfection 
of VSMC was performed using the AMAXA Nucleofector™ Kit (Amaxa, Inc., Gaithersburg, MD, USA) 
following the manufacturer's instructions as we described (Gabunia et al., 2016, 2017). For overexpression 
studies, human AdenoFXR1 was purchased from Vigene Biosciences (Rockville, MD, USA). The 
AdenoFXR1 and control virus AdenoGFP were used at 100 MOI in the transduction of hVSMCs.  Forty-eight 
hours after infections, VSMC were serum starved 24 hours, then treated as described in the legend.  For 
luciferase experiments, 6µg of a constitutively-driven luciferase reporter vector (LightSwitch™ 3′UTR 
Reporter Vector, Switchgear Genomics, Menlo Park, Ca, USA) which contains multiple ARE tandem repeats 
was transfected into HEK using Fugene transfection reagent (Promega, Madison, WI, USA), and co-
transduced with plasmid encoding FXR1 cDNA (6µg).  Forty-eight hours after transfection, luciferase activity 
was quantitated as we have described using LightSwitch™ Luciferase Assay Kits (Gabunia et al., 2016).  
 
  


FXR1 Is an IL-19-Responsive RNA-Binding Protein that Destabilizes Pro-inflammatory Transcripts in Vascular Smooth Muscle Cells

https://authors.library.caltech.edu/88371/2/1-s2.0-S2211124718310799-mmc1.pdf

FXR1 Is an IL-19-Responsive RNA-Binding Protein that Destabilizes Pro-inflammatory Transcripts in Vascular Smooth Muscle Cells

Abstract

Similar works

Full text

Available Versions

Caltech Authors - Main