Burmann, B.

Gottesmann, M.

Luo, X.

Roesch, P.

Wahl, M.

MPG.PuRe

Supplemental Material:Table S1: Mutation primers used to construct nusB variantsConstruct	5' Primer	3' PrimerNusB	GGAGATATACATATGAAACCTGCTGCTCGTC	GACGAGCAGCAGGTTTCATATGTATATCTCCNusBD118N	GTTCGGCGCAGAAAACAGCCATAAGTTCGTC	GACGAACTTATGGCTGTTTTCTGCGCCGAACNusBD118A	GTTCGGCGCAGAAGCAAGCCATAAGTTCGTC	GACGAACTTATGGCTTGCTTCTGCGCCGAACNusBD118R	GTTCGGCGCAGAAAGAAGCCATAAGTTCGTC	GACGAACTTATGGCTTCTTTCTGCGCCGAACNusBD118E	GTTCGGCGCAGAAGAAAGCCATAAGTTCGTC	GACGAACTTATGGCTTTCTTCTGCGCCGAACNusBD118K	GTTCGGCGCAGAAAAAAGCCATAAGTTCGTC	GACGAACTTATGGCTTTTTTCTGCGCCGAACTable S2: 3′-6-carboxyfluorescein (6-Fam)-labeled RNA oligonucleotides (Biomers, Ulm, Germany) used in this study. BoxA nucleotides are shown in bold. Mutated nucleotides are underlined. Oligonucleotide 	SequencerrnG BoxA-spacer	5'-CACUGCUCUUUAACAAUUA-3'rrnG BoxA	5'-UGCUCUUUA-3'nutR BoxA-spacer	5'-CGCUCUUACACAUUCCA-3'nutL BoxA-spacer	5'-CGCUCUUAAAAAUUAA-3'nutR BoxA	5'-CGCUCUUA-3'nutR-spacer	5'-CACAUUCCA-3'nutL-spacer	5'-AAAAUUAA-3'nutR-BoxA5-spacer	5'-CUCUCUUACACAUUCCA-3'nutR-BoxA16-spacer	5'-CGCUAUUACACAUUCCA-3'nutR-BoxA69-spacer	5'-AUAGCGGCCACAUUCCA-3'nutR-BoxA(U39G)-spacer	5'-CGCUCGUACACAUUCCA-3'Table S3: Dissociation constants obtained by NusBD118N (NusB101) titration to different concentrations of fluorescein labeled rrnG BoxA. Buffer was 25 mM HEPES, 100 mM potassiumacetate, pH 7.5. rrnG BoxA [nM]	Kd [nM]5	66 ± 2050	50 ± 15100	100 ± 24Supplemental Figure Legends:Figure S1: Fluorescence anisotropy measurements with fluorescein labeled λnut and rrnG RNAs titrated to NusB/NusEΔloop. Each titration was performed with 50 nM fluorescein labeled RNA. rrnG BoxA(open circles), rrnG BoxA-spacer (filled circles), nutR BoxA (open squares), nutR BoxA-spacer (filled triangles), nutL BoxA-spacer (open triangles) Lines represent the best fit to equation (3).Supplemental Figure:Fig. S1:

Fine tuning of the E-coli NusB: NusE complex affinity to BoxA RNA is required for processive antitermination.

Abstract

Similar works

Full text

Available Versions

MPG.PuRe