Background: In recent years, an increase in antibiotic resistance has been observed in Salmonella in different countries. The aim of this study was to determine the tetracycline and enrofloxacine resistance in salmonella isolated from poultry.

Methods: The pattern of antibiotic resistance to tetracycline and

enrofloxacin in isolated Salmonella of fecal broiler chickens from Shiraz, southern Iran, was assessed using minimum inhibitory concentration (MIC) and PCR methods.

Results: Of 100 fecal samples of broiler chickens, 5 samples (5%) were infected to Salmonella. The antimicrobial susceptibility showed that MIC90 of isolated Salmonella strains for enrofloxacin and tetracycline was less than 0.2 μg/mL and 180 μg/mL, respectively, indicating a high sensitivity to these antibiotics. In two samples the presence of tetracycline resistance plasmid was also found, while all the strains were susceptible to enrofloxacin.

Conclusion: According to the results, the isolated Salmonella spp.

showed higher resistance to tetracycline than enrofloxacin, which seems due to the excessive usage of this antibiotic in poultry industry

Fahimeh Khojasteh

Maryam Poormontaseri

Mehdi Fazeli

Saeid Hosseinzadeh

Directory of Open Access Journals

Khojasteh et al.Int J Nutr Sci March 2018;3(1) 38Determination of Tetracycline and Enrofloxacine Resistance in Salmonella Isolated From PoultryFahimeh Khojasteh1, Saeid Hosseinzadeh1*, Mehdi Fazeli2, Maryam Poormontaseri11. Department of Food Hygiene and Public Health, School of Veterinary Medicine, Shiraz University, Shiraz, Iran2. Department of Basic Sciences, School of Veterinary Medicine, Shiraz University, Shiraz, IranA R T I C L E  I N F OOriginal Article Keywords:Antibiotic resistanceSalmonellaPoultryIranABSTRACTBackground: In recent years, an increase in antibiotic resistance has been observed in Salmonella in different countries. The aim of this study was to determine the tetracycline and enrofloxacine resistance in salmonella isolated from poultry. Methods: The pattern of antibiotic resistance to tetracycline and enrofloxacin in isolated Salmonella of fecal broiler chickens from Shiraz, southern Iran, was assessed using minimum inhibitory concentration (MIC) and PCR methods. Results: Of 100 fecal samples of broiler chickens, 5 samples (5%) were infected to Salmonella. The antimicrobial susceptibility showed that MIC90 of isolated Salmonella strains for enrofloxacin and tetracycline was less than 0.2 μg/mL and 180 μg/mL, respectively, indicating a high sensitivity to these antibiotics. In two samples the presence of tetracycline resistance plasmid was also found, while all the strains were susceptible to enrofloxacin. Conclusion: According to the results, the isolated Salmonella spp. showed higher resistance to tetracycline than enrofloxacin, which seems due to the excessive usage of this antibiotic in poultry industry. *Corresponding author: Department of Food Hygiene and Public Health, School of Veterinary Medicine, Shiraz University, P. O. Box: 71441-69155, Shiraz, IranTel: +98-713-6138743Fax: +98-713-2286950Email: hosseinzadeh@shirazu.ac.ir Received: August 25, 2017Revised: February 29, 2018Accepted: March 15, 2018International Journal of Nutrition SciencesJournal Home Page: ijns.sums.ac.irPlease cite this article as: Khojasteh F, Hosseinzadeh S, Fazeli M, Poormontaseri M. Determination of Tetracycline and Enrofloxacine Resistance in Salmonella Isolated From Poultry. Int J Nutr Sci 2018;3(1):38-43.Int J Nutr Sci 2018;3(1):38-43IntroductionNon-typhoidal Salmonella is known as one of the most important food-producing pathogens with high prevalence in worldwide. Raw foods, including poultry meat, eggs, and red meat are considered as the main sources of Salmonella infection. Nowadays, global concerns about Salmonella multi-drug resistance, as a human health threatening, are increasing. Several outbreaks of food-borne diseases have been reported for Salmonella enterica (1-3). A common way caused multi-drug resistance is transferring of mobile genetic materials, including transposons and plasmids (2-4).Since one of the main problems in food industry is infection of chicken meat with this pathogen, antibiotics are commonly used in the treatment and prevention of the disease. Regarding that the antibiotic resistance can easily be transfer by plasmid genes, this study was carried out using phenotypic and molecular assays in order to identify accurate genetic patterns of antibiotic resistance and their incidence in broiler chickens in Shiraz, southern Iran.Materials and MethodsIn this study, 100 broiler chickens from Shiraz Antibiotic resistance in SalmonellaInt J Nutr Sci March 2018;3(1)  39farms were collected in 2011. In order to obtain fecal specimens from broiler chickens, direct swabs from stool were provided. All samples were transferred to glass tubes containing 10 ml of selenite medium and incubated at 37°C for 24 hours. Following the enrichment procedure, the specimens were sub-cultured onto the selective culture media, brilliant green agar and xylose lysine deoxycholate (XLD) agar and incubated at 37°C for 24 hours. Biochemical tests for urea, lysine, sulfuric acid, methyl ester and indole were used to confirm the suspected colonies.DNA Extraction was undertaken using DNA extraction kit (Cinna Gene, Iran). Then, the bacterial specimens were transferred to 1.5 μL tubes and centrifuged for 10 minutes at 12000 rpm. The supernatant was discarded and 200 μL of lysis buffer and 40 μL of proteinase K were added and incubated for 15 minutes at 65°C. Then, 30 μl of distilled water was added to the purified DNA and kept at -20°C until use. The DNA concentration was estimated by optical absorption at 260 nm and its purity was determined using nanodrop in 260/280 nm absorbance.PCR assay was performed to identify tetracycline (tetA) and enrofloxacin (gyrA) resistance using specific primers. For tetA as F 5’ GTGAAACCCAACCATACCCC 3’ and R 5’ GAAGGCAAGGAGGATGTAG 3’. For gyrA as F 5’ATGAGCGAATTAGCCAAAGA 3’  and R 5’GCAACCGTCCAACACTTCAT 3’. The components of the PCR reaction in a final volume of 25 μL contain 1 μL template DNA, 2.5 μL PCR buffer, 0.5 μL of Taq DNA polymerase enzyme (5 μg/μL), 0.5 μL of each primer (10 μmol) 1 μL of the DNTP mixture (2.5 mmol), and 1.5 μL of MgCl2 (50 mmol) which were mixed together (CinnaGen, Iran).The PCR reaction was conducted as 30 cycles, using thermocycler (Ependorf, Germany). The initial denaturing was performed at 94°C for 3 minutes. Then, 25 cycles of denaturation for 1 min at 94°C was performed. For gyrA, 1 min at 55°C and for tetA, 1 min at 53°C were undertaken, and repeated at 72°C for another 1 minute. The final proliferation was performed at 72°C for 10 minutes (2). To evaluate the PCR, 5 μL of the product was transferred to 1% agarose gel and stained with ethydium bromide and observed under ultraviolet light at 582 and 890 bp for enrofloxacin and tetracycline, respectively.Inducing the antibiotic resistance was also performed in Salmonella. The sensitive bacterial specimens to enrofloxacin and tetracycline were further assessed by minimum inhibitory concentration (MIC) test. For this purpose, Salmonella was initially cultured in a tryptic soy broth (TSB) medium, and incubated at 37°C for 24 hours. The bacterial suspensions and each antibiotic (tetracycline at the concentration of 300 μg/mL or enrofloxacin at the concentration of 1 μg/mL) were added to the TSB medium and incubated at the same condition. The preparations were then sub-cultured onto the McConkey agar medium and incubated as before. The growing colonies showed their resistant to each antibiotic which were further confirmed by a PCR assay.The MIC experiment was performed using a 96-well microplate. At first, 100 μL TSB medium was added to each well, then two folded dilutions of oxytracycline at the concentration of 300 μg/mL and enrofloxacin at the concentration of 1 μg/mL were added to the culture medium. Ten microliter of Salmonella suspension (both resistant and non-resistant ones), with 107 CFU/mL was added to each well. Each experiment was performed in four replications. Also, the TSB medium containing Salmonella typhimurium as positive control and antibiotic and the TSB medium as a negative control were also transferred into wells. The minimum concentration of the antibiotic inhibiting bacterial growth was considered as MIC (5, 6).ResultsOut of 100 fecal samples collected from broiler chickens, 5% of the samples were infected with Salmonella. Of which, 2% were found resistance to tetracycline (40%, Figure 1); while all 5 samples were sensitive to the enrofloxacin antibiotic. Samples that were resistant to tetracycline and enrofloxacin antibiotics were also tested by PCR, to visualize the antibiotic resistance patterns (Figure 1 and 2).Figure 1: Results of agarose electrophoresis of tetracycline resistance gene in the 1%  gel. M: Marker 100 bp, line 1: Negative control, line 2: Positive control (Plasmid (pMOBGIII) 890 bp, line 3: Positive sample.Khojasteh et al.Int J Nutr Sci March 2018;3(1) 40Details of the resistance bacteria isolated from the fecal samples to both antibiotics are given in Tables 1-4 and Figures 3 and 4. The MIC values of non-resistant and resistant strains were respectively 99.1±1.2% and 41.8±3.8%, at the concentration of 300 μg/mL tetracycline. Furthermore, MIC90 was 180 μg/mL for non-resistant tetracycline strains, while the MIC50 was 300 μg/mL for resistant strains. However, the MIC values for non-resistant and resistant strains were respectively 99.7±0.4% and 47.5±3.2%, at the concentration of 1 μg/mL enrofloxacin. MIC90 for non-resistant strains to enrofloxacin was less than 0.2 μg/mL and MIC50 for resistant strains was about 0.9 μg/mL.DiscussionAntibiotic resistance is one of the problems and obstacles of treating bacterial diseases in animals, Figure 2: Results of agarose electrophoresis of enrofloxacin resistance gene in a 1% gel: 100 bp marker, line 1: Negative control, line 2: Positive sample 582 bp.Table 1: Percent of growth inhibition of isolated non-resistant Salmonella to tetracycline in MIC test.Positive samplesConcentration of tetracycline (μg/L)300 150 75 37.5 18.75 9.38 4.68 2.341 99.9 89 80.9 66.1 60.3 49.3 30.8 25.82 97 90 84.1 74.4 70.2 60.9 54.7 40.53 100 89.7 83.5 79.9 76.4 65.1 62 58.94 99 96 89.8 83.5 80.6 72.5 69.3 65.25 100 96.5 94.3 91 89.9 80.8 79.9 77.1Table 2: Percent of growth inhibition of isolated resistant Salmonella to tetracycline in MIC test.Positive samplesConcentration of tetracycline (μg/L)300 150 75 37.5 18.75 9.38 4.68 2.341 42.4 38.6 32.9 27.7 23.2 21.9 17.3 12.42 40 39.6 34.4 34.1 27.2 24.7 19.2 9.93 46 44.2 40.6 37.4 26.1 21.7 18.2 10.54 36.3 35.8 31.2 29.3 25.5 20 16 9.45 44.7 40 38 32.8 30 26.6 19.8 7.6Table 3: Percent of growth inhibition of isolated non-resistant Salmonella to enrofloxacine in MIC test.Positive samplesConcentration of enrofloxacine (μg/L)1 0.5 0.25 0.125 0.06 0.03 0.015 0.0071 100 99.9 97.6 97.4 96.6 95.7 91.7 97.12 100 99.2 98.7 97.1 96.6 94.9 92.9 95.23 99.9 98.3 97.2 96.6 95.7 90.9 90.6 90.34 99.8 98.8 97.9 96.9 95.4 92.6 91.9 88.35 98.9 98.4 97.7 97.1 96.6 98 96.9 90.5 Table 4: Percent of growth inhibition  of isolated resistant Salmonella to enrofloxacine in MIC test.Positive samplesConcentration of enrofloxacine (μg/L)1 0.5 0.25 0.125 0.06 0.03 0.015 0.0071 49.7 47.4 38.9 32 27.2 24.2 16.2 1072 50 46.6 40 39.4 35.9 26.5 15.6 10.63 47.5 43.5 39.5 37.5 35 20.1 16.6 4.44 48.6 43.8 35.4 32.7 25.9 19 13.1 105 42 40 39.7 37.8 33.9 25.5 19.6 12.5Antibiotic resistance in SalmonellaInt J Nutr Sci March 2018;3(1)  41poultry and humans. As such, in a short period of time, resistance to a new and effective antibiotic is problematic and practically its use becomes limited. This resistance has been mainly observed in human pathogens, the causes of common diseases between humans and animals and indigenous bacteria in food. According to a previous study, it was shown that antibiotic resistance was rapidly transferred to Enterobacteriaceae. In the event of contamination of foodstuff to the bacteria with multi-drug resistance, the resistance would be transferred to intestinal microflora, and this flora remained an antibiotic resistance reservoir (7).In this study, the transmission pattern of antibiotic resistance was investigated in Salmonella isolated from slaughtered poultry carcasses in Shiraz slaughterhouse using a PCR assay. The results showed that the resistance of this pathogen to tetracycline (40%) was higher than that of enrofloxacin (None). In a previous study, antibiotic resistance in Salmonella isolates between 1980 and 1998 was increased from 20% to 40% (8). The increased antibiotic resistance in S. typhimurium isolated from chickens to ampicillin, tetracycline and chloramphenicol led to the emergence of multidrug resistance strains (9, 10). In another study, the resistance of isolated Salmonella of dietary intake to tetracycline and enrofloxacin were 90% and 15%, respectively (2). Previous studies revealed that Salmonella was a major reservoir of antibiotic resistance in both human and animals. It was also demonstrated that 75% of Salmonella isolated from pigs were resistant to ampicillin, chloramphenicol, streptomycin, sulfamethoxazole and kanamycin antibiotics. In human a record of resistance to 10 types of antibiotics was also remarkable finding (11). It was shown that a high proportion of Escherichia coli isolated from faeces and poultry carcasses remained resistant to tetracycline, streptomycin, ampicillin and sulfonamides. The occurrence of the resistances was directly associated with the rate of antibiotic use in the poultry industries both as preventive and growth-promoting factor. It was shown that 15.4% of isolated strains were able to transfer their resistance mobile genes to the laboratory strain of Escherichia Figure 3: Mean percent of growth inhibition of resistant and non-resistant Salmonella to tetracycline. Figure 4: Mean percent of growth inhibition of resistant and non-resistant Salmonella to enrofloxacin.Khojasteh et al.Int J Nutr Sci March 2018;3(1) 42coli K12 (12). In another study, Salmonella enterica isolated from chickens revealed the highest resistance to chloramphenicol, ampicilin and tetracycline, respectively, from which, 43.7% had multi-drug resistance and 10.7% had single-drug resistance (13). The extensive use of antibiotics for the purpose of treatment or prevention, led to a significant increase in the transferable plasmid antibiotic resistance. Use of enrofloxacin promoted the spread of strains with a low sensitivity to quinolones (14). It was demonstrated that the emergence of resistant strains of S. enterica to fluoroquinolones is increasing (15). In this study, antimicrobial susceptibility to enrofloxacin and tetracycline was also assessed by applying MIC method. All strains isolated from Salmonella were susceptible to enrofloxacin, of which, MIC90 sensitivity to enrofloxacin for the isolated strains was less than 0.2 mg/mL. This was similar to the results of other studies on Salmonella isolated from poultry meat, as well as some Salmonella strains isolated from animal sources (5, 16). In addition, MIC90 sensitivity to tetracycline for the isolated strains was about 180 μg/mL. The unlimited use of antibiotics to prevent diseases and as growth promotion, can be considered as the main reasons for the emergence of antibiotic resistance. Due to the consumption of contaminated livestock products, resistant organisms in the human digestive system transmit the resistance factor to the natural flora of the digestive tract. When a bacterial disease containing resisting factor, the treatment process becomes difficult, the possibility of recovery decreases, and the dose of the drug intake raises. The development of antibiotic resistance in recent decades requires the cautious use of antimicrobial agents in veterinary and medical care, and there should be strategies to stop the increasing trend of antibiotic resistance.ConclusionBased on the results of this study, the prevalence of tetracycline resistance Salmonella was higher than enrofloxacin, which seems to be due to the extensive use of this antibiotic in the poultry industry. However, studies on the multi-drug antibiotic resistance mechanisms are advised.AcknowledgementThe current work was kindly supported by School of Veterinary Medicine, Shiraz University.Conflict of InterestNone declared.References1 Chuanchuen R, Padungtod P. Antimicrobial resistance genes in Salmonella enterica isolates from poultry and swine in Thailand. J Vet Med Sci. 2009;71:1349-1355. DOI:1292/jvms.001349. PMID:19887742.2 Ribeiro VB, Lincopan N, Landgraf M, et al. Characterization of class 1 integrons and antibiotic resistance genes in multidrug-resistant Salmonella enterica isolates from foodstuff and related sources. Braz J Microbiol. 2011;42:685-692. DOI:1590/S1517-838220110002000033. PMID:24031680.3 Thai TH, Yamaguchi R. Molecular characterization of antibiotic-resistant Salmonella isolates from retail meat from markets in Northern Vietnam. J Food Prot. 2012; 75:1709-1714. DOI:4315/0362-028X.12-101. PMID:22947480.4 Brock TD, Madigan MT, Martinko JM, et al. Biology of Microorganisms. Prentice Hall. New Jersey. 1991;19862.5 Asai T, Itagaki M, Shiroki Y, et al.  Antimicrobial resistance types and genes in Salmonella enterica infantis isolates from retail raw chicken meat and broiler chickens on farms. J Food Prot. 2006;69:214-216. DOI: 4315/0362-028x-69.1.214. PMID:16416922.6 Hong H, Huang JM, Khaneja R, et al. The safety of Bacillus subtilis and Bacillus indicus as food probiotics. J Appl Microbiol. 2008;105:510-520. DOI:1111/j.1365-2672.2008.03773.x. PMID: 18312567.7 Blake D, Hillman K, Fenlon D, et al. Transfer of antibiotic resistance between commensal and pathogenic members of the Enterobacteriaceae under ileal conditions. J Appl Microbiol. 2003;95:428-436. DOI:1046/j.1365-2672.2003.01988.x.8 Matsushita S, Yamada S, Inaba M, et al. Serovar distribution and drug resistance of Salmonella isolated from imported and domestic cases in 1980-1989 in Tokyo. Kansenshogaku Zasshi. 1992;66:327-339. DOI:11150/kansenshogakuzasshi1970.66.327. PMID: 1624821.9 Breuil J, Brisabois A, Casin I, et al. Antibiotic resistance in Salmonella isolated from humans and animals in France: comparative data from 1994 and 1997. J Antimicrob Chemother. 2000;46:965-971. DOI:1093/jac/46.6.965. PMID: 11102416.10 Van Duijkeren E, Wannet W, Houwers D, et al. Antimicrobial susceptibilities of Salmonella strains isolated from humans, cattle, pigs, and chickens in the Netherlands from 1984 to 2001. Antibiotic resistance in SalmonellaInt J Nutr Sci March 2018;3(1)  43J Clin Microbiol. 2003;41:3574-3578. DOI:1128/jcm.41.8.3574-3578.2003. PMID:12904357.11 Gebreyes WA, Thakur S. Multidrug-resistant Salmonella enterica serovar Muenchen from pigs and humans and potential interserovar transfer of antimicrobial resistance. Antimicrob Agents Chemother. 2005;49:503-511. DOI:1128/AAC.49.2.503-511.2005. PMID:15673725.12 Nazer AH. Transmissible drug resistance in Escherichia coli isolated from poultry and their carcasses in Iran. Cornell Vet. 1980;70:365-371. PMID:7006910.13 Hernandez T, Rodriguez-Alvarez C, Arevalo M, et al. Antimicrobial-resistant Salmonella enterica serovars isolated from chickens in Spain. J Chemother. 2002;14:346-350. DOI:1179/joc.2002.14.4.346. PMID:12420851.14 Randall LP, Eaves DJ, Cooles SW, et al. Fluoroquinolone treatment of experimental Salmonella enterica serovar Typhimurium DT104 infections in chickens selects for both gyrA mutations and changes in efflux pump gene expression. J Antimicrob Chemother. 2005;56:297-306. DOI:1093/jac/dki189. PMID:15956100.15 Cui S, Ge B, Zheng J, et al. Prevalence and antimicrobial resistance of Campylobacter spp. and Salmonella serovars in organic chickens from Maryland retail stores. Appl Environ Microbiol. 2005;71:4108-4111. DOI:1128/AEM.71.7.4108-4111.2005. PMID:16000828.16 Giraud E, Brisabois A, Martel JL, et al. Comparative studies of mutations in animal isolates and experimental in vitro and in vivo selected mutants of  Salmonella spp. Suggest a counterselection of highly fluoroquinolone-resistant strains in the field. Antimicrob Agents Chemother. 1999;43:2131-2137. PMID:10471553.

Determination of Tetracycline and Enrofloxacine Resistance in Salmonella Isolated From Poultry

https://ijns.sums.ac.ir/article_43440_fda4be4495aed32305f8a8b5df2ceff4.pdf

Determination of Tetracycline and Enrofloxacine Resistance in Salmonella Isolated From Poultry

Abstract

Similar works

Full text

Available Versions

Directory of Open Access Journals