We studied the effect of HCMV (AD-169) on the regulation of PAR1 reporter activity in HUVEC. In HUVEC, HCMV significantly induced activation of PAR1 reporter constructs carrying AP-2-like and two complexes of AP-2/Sp1-binding elements. Shorter constructs with no AP-2-like binding elements had lower activity upon virus inoculation. Moreover, activity of the shortest construct without binding elements was not significantly increased in virus-exposed cells. Furthermore, in HCMV-exposed cells, activity of the PARI reporter was significantly augmented upon p52/RelB transfection. Taken together, the data indicate that activity of the PAR1 promoter is highly dependent on AP-2/Sp1 binding elements and mediated by p52/RelB regulatory factors

Burysek, L.

Duric-Delic, Tamara

Paskas, Svetlana

Popović, Milan

Stanković, Aleksandra

Živković, Maja

Archives of Biological Sciences

Đurić-Delić, Tamara

Repository of the Vinča Nuclear Institute (VinaR)

INTRODUCTIONHuman cytomegalovirus (HCMV) is a member of the Betaherpesviridae family and subfamily Betaherpesvirinae that establishes a life-long per-sistent infection (Huang and Kowalik, 1993). In immunocompromised patients, such as individuals with AIDS and patients taking immunosuppressive drugs following transplantation, HCMV may cause severe disease (Britt and Alford, 1996). This virus is a cause of the most important congenital infection and may lead to developmental damage of the cen-tral nervous system including hearing loss, mental retardation, and visual impairment (Alford et al., 1990).Protease-activated receptors (PAR) 1, 3, and 4 are responsible for the cellular response to throm-bin, the key effector protease of the coagulation cascade (Coughlin, 2005). These receptors belong to a family of 7-transmembrane G protein-linked receptors proteolytically and irreversibly activated by thrombin (Brass et al., 1994; Hein et al., 1994). Described as the prototypical thrombin receptor, PAR-1 is rapidly desensitized after activation, fol-lowed by internalization and trafficking in the lyso-somes. Recovery of thrombin responsiveness is due to replenishment of the cell surface with new recep-tors (Hein et al., 1994). The presence of a protected intracellular PAR-1 pool in many cell types (such as ECs, smooth muscle cells, and fibroblasts) with at least as many receptors as are present initially on the cell surface provides a mechanism for quick recov-ery after activation, independent of protein synthe-sis (Woolkalis et al., 1995; Ellis et al., 1999). In the absence of an agonist, PAR-1 cycles at very low rates between the cell surface and the intracellular pool (Shapiro et al., 1996; Shapiro and Coughlin, 1998) and the time required for new PAR-1 synthesis after cleavage by thrombin is 24 hours (Yan et al., 1996).The regulatory region of the human thrombin receptor gene has been cloned, and DNA sequence analysis indicates the presence of many regulatory IN HCMV-EXPOSED HUVEC, P52/RElB REGUlATORY FACTORSMEDIATE ACTIVATION OF THE HUMAN PAR1 GENE PROMOTERM. POPOVIĆ1, 2, SVETLANA PASKAŠ3, MAJA ŽIVKOVIĆ2, TAMARA ĐURIĆ-DELIĆ2,ALEKSANDRA STANKOVIĆ2, and L. BURYSEK1, 41Institute of Pharmacology of Natural Products and Clinical Pharmacology, Ulm University, D-89081 Ulm, Germany2Laboratory of Radiobiology and Molecular Genetics, Vinča Institute, 11001 Belgrade, Serbia3Max-Delbrück Center for Molecular Medicine, 13125 Berlin, Germany4Gen-Trend Ltd., 370 04 České Budějovice, Czech RepublicAbstract — We studied the effect of HCMV (AD-169) on the regulation of PAR1 reporter activity in HUVEC. In HUVEC, HCMV significantly induced activation of PAR1 reporter constructs carrying AP-2-like and two complexes of AP-2/Sp1-binding elements. Shorter constructs with no AP-2-like binding elements had lower activity upon virus inoculation. Moreover, activity of the shortest construct without binding elements was not significantly increased in virus-exposed cells. Furthermore, in HCMV-exposed cells, activity of the PAR1 reporter was significantly augmented upon p52/RelB transfection. Taken together, the data indicate that activity of the PAR1 promoter is highly dependent on AP-2/Sp1 bind-ing elements and mediated by p52/RelB regulatory factors.Key words: HCMV, PAR1 gene reporter, HUVECUDC 578.2:578.7:577.2 613Arch. Biol. Sci., Belgrade, 61 (4), 613-618, 2009                  DOI:10.2298/ABS0904613PM. POPOVIĆ ET AL.614factor-binding elements, including two AP-2/Sp1 complexes in the proximal 3’ region of the promoter. Overall, these complexes contain four putative AP-2-binding elements (Tellez and Bar-Eli, 2003) and seven Sp1-binding elements (Wu et al., 1998) as shown in Fig. 1. The regulatory region of the throm-bin receptor gene shares remarkable similarities with some other AP-2 target genes, such as a GC-rich sequence, lack of conventional TATA sequences, and multiple AP-2-binding elements (Tellez et al., 2003; Tellez and Bar-Eli, 2003).Here we sought to determine the minimal HCMV-responsive element within the PAR1 pro-moter and investigate if promoter activity could be mediated by NF-κB transcription machinery (Ghosh et al., 1998), in particular p52/RelB, upon HCMV exposure. MATERIAL AND METHODSCell isolation and cultureHuman umbilical vein endothelial cells (HUVEC) were isolated and maintained as previously described (Laumonnier et al., 2000). In all experiments, HUVEC were used between passages 2 and 6.Virus culture and determination of virus titerHuman cytomegalovirus, laboratory strain AD-169 (HCMV-AD169), was purchased from ATCC and propagated in MRC-5 cells. A confluent monolayer of MRC-5 cells was inoculated with virus [0.01 cytopathic effects (CPE) per cell] in serum-free medium. Cells were washed after 90 min and further cultured in growth medium until cytopathic effects were apparent in approximately 100% of cells. Infected cells were then replenished by fresh culture medium. After 5 days, the supernatant containing viral particles was collected and centrifuged at 1000x rcf at 4°C for 15 min. To sediment virus particles, debris-free supernatant was then subjected to ultracentrifugation at 20000 rcf at 4°C for 1 h. The supernatant was carefully discarded and the virus pellet resuspended in 500 µl of growth medium, aliquoted, and stored at -80°C for further use. For each independent experiment, fresh aliquots from the same preparation were used.The virus titer was determined by virus plaque assay. Virus samples were serially diluted in serum-free medium and adsorbed to MRC-5 cells plated in 24-well plates at a density of 105 cells per well. Inoculum was replaced with culture medium after 90 min. After 10 days, the cells were stained with Giemsa solution. White plaques were counted and the virus titer was presented as the number of cytopathic effects (CPE) per volume of infected medium, also known as the multiplicity of infection (MOI).PAR1 promoter deletions and expression plasmidsWe made PAR1 promoter deletions by PCR amplification using the Advantage GC Genomic PCR kit having GC melt in order to break strong guanine-cytosine bonds in the genomic DNA. Primers were designed to carry restriction sites for SacI and XhoI restriction enzymes, providing so-called “sticky ends”. Further, constructs were cloned into the pGL-3Enhancer luciferase reporter vector (Promega GmbH, Mannheim, Germany) in the multiple cloning region between the aforementioned restriction sites. Primer sequences of constructs and PCR condition are given in Table 1.The p52 and RelB expression plasmids were kindly provided by the Papillomavirus Research Unit, University of Quensland, Australia. Expression plasmids were cloned into the EcoRV and NotI restriction sites of the pcDNA3 vector (Promega GmbH, Mannheim, Germany).Fig. 1. Putative transcriptional regulatory sequences of the PAR1 gene (Tellez, C., Oncogene 2003; 22: 3130-3137).THE P52/RELB MODULATE ACTIVITY OF PAR1 REPORTER GENE 615Gene reporter assayThe HUVEC used were either mock- or HCMV-exposed (MOI 5) in serum-free medium for 1 h, washed, and transiently transfected with PAR1 pGL-3Enhancer luciferase reporter  constructs containing full-length and progressively shorter promoter sequences of the human PAR1 gene alone or together with p52 + RelB (p52/RelB) expression plasmids using the SuperFect transfection reagent according to instructions provided by the manufacturer (Quiagen GmbH, Hilden, Germany). After 48 h, cells were harvested and lyzates were assayed for luciferase activity using the Luciferase Reporter Assay System kit (Promega, Madison, WI, USA) in a plate luminometer (Stratec Biomedicine Systems AG, Birkenfeld, Germany). We used HUVEC tansfected with a vector containing the luciferase gene to control non-specific viral effects. Results were normalized to the luciferase activity in mock-transfected HUVEC.Statistical analysisValues shown represent means ± SEM. Statistical significances were calculated with the Newman-Keuls test for multi-group comparisons.RESULTSHuman cytomegalovirus significantly increasesactivity of PAR1 reporter deletion constructsThe regulatory region of the human thrombin receptor gene has been cloned. Analysis of DNA sequences indicates the presence of many transcrip-tion factor-binding elements, including 2 AP-2/Sp1 complexes in the proximal 3´ region of the promoter (Schmidt et al., 1996; Wu et al., 1998; Tellez and Bar-Eli, 2003). In HUVEC, basal activities of trans-fected reporter constructs did not differ significantly when compared to the full-length PAR-1106 con-struct, though activity of the shortest one, PAR1-87, was approximately 30% lower compared to PAR1-1106 (Fig. 2). However, the virus did significantly induce activity of all constructs as compared to their respective basal activities with the exception of the PAR1-87 construct. Moreover, activity of PAR1-863 was significantly higher compared to PAR1-1106, suggesting the presence of a DNA sequence in the full-length promoter that interferes with HCMV activation of the PAR1 promoter. Human cytomegalovirus activates the PAR1promoter via p52/RelBTo investigate if p52/RelB transcription factors Table 1. Summary of PAR1 promoter deletion constructs. Deletion constructs were generated by PCR amplification. Reaction conditions were as follows: initial denaturation at 94oC for 5 min, 35 cycles of denaturation at 94oC for 30 sec, annealing at 64oC for 30 sec, and elongation at 72oC for 90 sec. All PCR reactions were run on GeneAmp PCR System 2400 PE and GeneAmp PCR System 9700.Construct 5’ primer 3’ primerPAR1-1106 (1,2kb) ATGCGAGCTCCCAGTGGCAAAGCAACTTATTACTCGAGCCTCCGGCGTGCAGTGAGAGTCTCTGCPAR1-863 (957bp) ATGCGAGCTCTTCTGTGGTC CCAGGTAATCCGATTACTCGAGCCTCCGGCGTGCAGTGAGAGTCTCTGCPAR1-526 (620bp)AGCTGAGCTCGCCGCTCTTC CTATTCCACTCGCAATTACTCGAGCCTCCGGCGTGCAGTGAGAGTCTCTGCPAR1-298 (392bp) GATCGAGCTCACTGAACTTT GCCGGTGTCCCAATTACTCGAGCCTCCGGCGTGCAGTGAGAGTCTCTGCPAR1-87 (181bp) ACTAGAGCTCCGAATCAACG GTGCCCAGAGGAATTACTCGAGCCTCCGGCGTGCAGTGAGAGTCTCTGCM. POPOVIĆ ET AL.616could mediate PAR1 reporter activation, mock- or HCMV-exposed HUVEC were transiently trans-fected with either the PAR1 reporter gene alone or together with p52/RelB. As shown in Fig. 3, trans-fection of p52/RelB increased basal activity of the PAR1 reporter gene threefold, but not significantly. However, in virus-inoculated cells, promoter activ-ity was significantly over-activated upon p52/RelB transfection compared to either p52/RelB trans-fected- or HCMV-inoculated cells.DISCUSSIONIn the present study, we showed that exposure to HCMV significantly increases activity of all PAR1 deletion constructs (Schmidt et al., 1996), with the exception of the shortest one, PAR1-87, when com-pared to their basal activities. Progressively shorter fragments carrying none of the AP-2-like binding elements (Schmidt et al., 1996) had markedly lower activities upon virus exposure when compared to Fig. 2. Human cytomegalovirus increases activity of PAR1 reporter constructs. Gene reporter assay: HUVEC, HMCV-(5 MOI) or mock-infected, were transfected with vectors encoding PAR1 reporter gene constructs. Cells were analyzed for luciferase activity after 48 h. Data were normalized to total protein concentration and presented as MEANS ± SEM of n = 6 independent experiments. ns – not significant, *p < 0.05, **p < 001, ***p < 0.0001.Fig. 3. The p52/RelB expression plasmids significantly increase PAR1 reporter activity in HCMV-exposed HUVEC. Gene reporter assay: HUVEC, HMCV-(5 MOI) or mock-infected, were transfected with vectors encoding either the PAR1 reporter gene alone or together with p52/RelB plasmids. Cells were analyzed for luciferase activity after 48 h. Data were normalized to total protein concen-tration and presented as MEANS ± SEM of independent experiments: n = 14 for the PAR1 promoter and n = 8 for p52/RelB. ns – not significant, *p < 0.05, **p <.001, ***p < 0.0001.THE P52/RELB MODULATE ACTIVITY OF PAR1 REPORTER GENE 617either PAR1-1106 or PAR1-863 constructs. This sug-gests an important (but not crucial) role for AP-2-like binding elements, since their activities in virus-exposed cells were still markedly higher than their corresponding basal activities. Interestingly, activity of PAR1-863 was higher than that of PAR1-1106, suggesting the presence of potentially inhibitory fac-tors in the full-length promoter. Furthermore, anal-ysis of PAR1-526-carrying complexes 1 (3 AP-2/5 Sp1) and 2 (1 AP-2/2 Sp1) and PAR1-298 carrying only complex 2 revealed comparable levels of activ-ity upon virus exposure, but still significantly higher when compared to their basal activities, suggesting an important role for complex 2. Moreover, activity of the PAR1-87 construct, carrying none of the regu-latory binding elements and none of the complexes, was only marginally increased when exposed to the virus, and its basal activity was approximately 30% lower than activity of PAR1-1106, pointing to a cru-cial role for complex 2 (Wu et al., 1998; Tellez and Bar-Eli, 2003). Taking all the data into account, we anticipated a crucial role for AP-2/Sp1 regulatory elements in con-cert with p52/RelB (Ghosh et al., 1998). However, it remains to be elucidated whether p52/RelB mediate PAR1 promoter activation directly or indirectly by influencing AP-2/Sp1 regulatory elements to bind to their corresponding binding sites within the PAR1 promoter.Acknowledgments — This work was supported by Deutsche Forschungsgemeinschaft. Milan Popovi�� and Maja Živkovi�� are      currently supported by a Serbian Government Research Grant     (M145023).REFERENCESAlford, C. A., Stagno, S., Pass, R. F., and W. J. Britt (1990). Congenital and perinatal cytomegalovirus infections. Rev. Infect. Dis. 12 (7), S745-S753.Brass, L. F., Ahuja, M., Belmonte, E., Blanchard, N., Pizarro, S., Tarver, A., and J. A. Hoxie (1994). Thrombin receptors: turning them off after turning them on. Semin. Hematol. 31, 251-260.Britt, W. A., and C. A. Alford (1996). Cytomegalovirus, In: Fields Virology, 3rd Ed., Vol. 2, 2493-2523. Lippincott-Raven Publishers, Philadelphia.Coughlin, S. R. (2005). Protease-activated receptors in hemo-stasis, thrombosis, and vascular biology. J. Thromb. Haemost. 3, 1800-1814.Ellis, C. A., Tiruppathi, C., Sandoval, R., Niles, W. D., and A. B. Malik (1999). Time course of recovery of endothelial cell surface thrombin receptor (PAR-1) expression. Am. J. Physiol. Cell Physiol. 276, C38-C45.Ghosh, S., May, M. J., and E. B. Kopp (1998). NF-kappa B and Rel proteins: evolutionarily conserved mediators of immune responses. Annu. Rev. Immunol. 16, 225-260.Hein, L., Ishii, K., Coughlin, S. R., and B. K. Kobilka (1994). Intracellular targeting and trafficking of thrombin recep-tors. A novel mechanism for resensitization of a G pro-tein-coupled receptor. J. Biol. Chem. 269, 27719-27726.Huang, E. S., and T. F. Kowalik (1993). The pathogenecity of human cytomegalovirus: an overview, In: Molecular Aspects of Human Cytomegalovirus Diseases (Eds. Y. Becker, G. Darai, and E. S. Huang), 1-45. Springer-Verlag, Berlin.Laumonnier, Y., Nadaud, S., Agrapart, M., and F. Soubrier (2000). Characterization of an upstream enhancer region in the promoter of the human endothelial nitric-oxide synthase gene. J. Biol. Chem. 275, 40732-40741.Schmidt, V. A., Vitale, E., and W. F. Bahou (1996). Genomic cloning and characterization of the human thrombin receptor gene. Structural similarity to the proteinase-activated receptor-2 gene. J. Biol. Chem. 271, 9307-9312.Shapiro, M. J., and S. R. Coughlin (1998). Separate signals for ago-nist-independent and agonist-triggered trafficking of prote-ase-activated receptor 1. J. Biol. Chem. 273, 29009-29014.Shapiro, M. J., Trejo, J., Zeng, D., and S. R. Coughlin (1996). Role of the thrombin receptor’s cytoplasmic tail in intracel-lular trafficking: distinct determinants for agonist-trig-gered versus tonic internalization and intracellular local-ization. J. Biol. Chem. 271, 32874-32880.Tellez, C., and M. Bar-Eli (2003). Role and regulation of the thrombin receptor (PAR-1) in human melanoma. Oncogene 22, 3130-3137.Tellez, C., McCarty, M., Ruiz, M., and M. Bar-Eli (2003). Loss of activator protein-2alpha results in overexpression of protease-activated receptor-1 and correlates with the malignant phenotype of human melanoma. J. Biol. Chem. 278, 46632-46642.Woolkalis, M. J., DeMelfi, T. M., Blanchard, N., Hoxie, J. A., and L. F. Brass (1995). Regulation of thrombin receptor on human umbilical vein endothelial cells. J. Biol. Chem. 270, 9868-9875.Wu, Y., Ruef, J., Rao, G. N., Patterson, C., and M. S. Runge (1998). Differential transcriptional regulation of the human thrombin receptor gene by the Sp family of transcription factors in human endothelial cells. Biochem. J. 330 (3), 1469-1474.Yan, W., Tiruppathi, C., Qiao, R., Lum, H., and A. B. Malik (1996). Tumor necrosis factor decreases thrombin recep-tor expression in endothelial cells. J. Cell Physiol. 166, 561-567.M. POPOVIĆ ET AL.618У HUVEC, ТРАНСКРИПЦИОНИ ФАКТОРИ P52/RElB ПОСРЕДУЈУ У АКТИВАЦИЈИ ЉУДСКОГ PAR1 ПРОМОТОРА ПОСЛЕ ИЗЛАГАЊА ВИРУСУ (HCMV)М. ПОПОВИЋ1, 2, СВЕТЛАНА ПАСКАШ3, МАЈА ЖИВКОВИЋ2, ТАМАРА ЂУРИЋ-ДЕЛИЋ2,АЛЕКСАНДРА СТАНКОВИЋ2 и Л. БУРИСЕК1, 41Institute of Pharmacology of Natural Products and Clinical Pharmacology, Ulm University, D-89081 Улм, Немачка2Лабораторија за радиобиологију и молекуларну генетику, Институт ”Винча”, 11001 Београд, Србија3Max-Delbrück Center for Molecular Medicine, 13125 Берлин, Немачка4Gen-Trend Ltd., 370 04 Чешке Буђејовице, Чешка РепубликаАутори су у овој студији анализирали утицај HCMV (AD-169) на регулацију активности PAR1 промотора у HUVEC. У овим ћелијама, излага-ње вирусу је значајно повећало активност PAR1 репортер конструката који носе AP-2-сличне везујуће елементе заједно са AP-2/Sp1-везујућим елементима организованим у два комплекса. Активност прогресивно краћих конструкти који немају AP-2-сличне везујуће елементе је била знатно смањена после излагања вирусу, али и даље значајно већа од њихових основних актив-ности  измерених у ћелијама које нису биле у додиру са вирусом. Међутим, активност најкра-ћег конструкта, који не поседује нити један везу-јући елемент, није била значајно повећана у ћели-јама изложеним вирусу нити је активност била значајно повећана у односу на основну актив-ност самог конструкта. Аутори су још показали да у ћелијама изложеним вирусу, транскрипцио-ни фактори p52/RelB значајно повећавају актив-ност PAR1 репортера. Аутори на крају дискусије закључују да је активност PAR1 промотора у великој мери зависна од присуства AP-2/Sp1-везујућих елемената, али и да транскрипциони фактори p52/RelB значајно регулишу активност промотора у ћелијама изложеним вирусу.

In Hcmv-Exposed Huvec, P52/Relb Regulatory Factors Mediate Activation of the Human Par1 Gene Promoter

M. Popovic

Svetlana Paskas

Maja Zivkovic

Tamara Djuric-Delic

Aleksandra Stankovic

L. Burysek

Crossref

In HCMV-exposed HUVEC, P52/RelB regulatory factors mediate activation of the human PAR1 gene promoter

In Hcmv-Exposed Huvec, P52/Relb Regulatory Factors Mediate Activation of the Human Par1 Gene Promoter

Abstract

Similar works

Full text

Available Versions

Repository of the Vinča Nuclear Institute (VinaR)

Crossref

MDC Repository

VinaR - Repository of the Vinča Institute of Nuclear Sciences