Selection-free genome editing using Cas9 ribonucleoprotein embryo bombardment has been achieved for maize and wheat. This is a breakthrough that should make new breeding technologies more acceptable for worldwide use

Puchta, H.

Wolter, F.

English

PubMed

Felix Wolter

Holger Puchta

Springer - Publisher Connector

Knocking out consumer concerns and regulator’s rules: efficient use of CRISPR/Cas ribonucleoprotein complexes for genome editing in cereals

KITopen

Wolter and Puchta Genome Biology  (2017) 18:43 DOI 10.1186/s13059-017-1179-1RESEARCH HIGHLIGHT Open AccessKnocking out consumer concerns andregulator’s rules: efficient use of CRISPR/Casribonucleoprotein complexes for genomeediting in cerealsFelix Wolter and Holger Puchta*AbstractSelection-free genome editing using Cas9ribonucleoprotein embryo bombardment has beenachieved for maize and wheat. This is a breakthroughthat should make new breeding technologies moreacceptable for worldwide use.criminated from a natural variant, which will alwaysIntroductionTwo recent publications show that it is possible to useCRISPR/Cas ribonucleoproteins (RNPs) to achieveselection-free site-directed mutagenesis by bombardingembryos of the main crop plants maize [1] and wheat[2]. But why is this exciting given that CRISPR/Cas tech-nology has been transforming plant biology for years?Multiple new tools have been developed for plant gen-ome engineering [3] and it has become possible to edit agreater variety of plant species [4]. Application of thetechnology is becoming more attractive for agronomicalpurposes. Recently, a number of genome-edited cropswith attractive traits have been produced [5]. The use ofCRISPR/Cas RNPs for mutation induction, first shown inhuman cells [6], has been achieved in protoplasts of sev-eral plant species [7]. Two recent publications in NatureCommunications from Svitashev et al. [1] and Liang et al.[2] demonstrate that the use of RNP-mediated editing isnow possible for two of the world’s most important cropplants, and that the farming of the resulting plants withimproved traits should not be blocked by regulation hur-dles worldwide as they cannot be regarded as geneticallymodified organisms (GMOs).* Correspondence: holger.puchta@kit.eduBotanical Institute, Karlsruhe Institute of Technology, Fritz-Haber-Weg 4,Karlsruhe 76131, Germany© The Author(s). 2017 Open Access This articInternational License (http://creativecommonsreproduction in any medium, provided you gthe Creative Commons license, and indicate if(http://creativecommons.org/publicdomain/zeDifferent standards worldwide: is the process orproduct relevant?When coming to the question of when a crop should beregarded as GMO, in many cases the answer you get willdepend on the place where you ask it, at least from alegal point of view. From the scientific point of view, theanswer is easy: if the respective plants cannot be dis-apply for plants that carry an induced mutation of oneor a few changed nucleotides without a transgene inser-tion in their genomes, it is completely pointless to clas-sify them as GMOs. One always has to keep in mindthat classic mutagenesis by chemicals, as well as radi-ation, is widely used for the production of new varietiesof crops.Radiation-induced double-strand breaks (DSBs) arealso repaired by the same “natural” pathways asCRISPR/Cas [5]. The drawback of the classic strategy isthat attractive mutations can only be obtained in an un-directed manner and at the cost of many more un-wanted changes in the same genome that can only partlybe eliminated from the final product by outcrossing.Nevertheless, over 3000 crop varieties have been pro-duced over the years using radiation mutagenesis andare used worldwide without the slightest legalrestriction.In the USA, three agencies are responsible for theregulation of GMOs: the Department of Agriculture(USDA), the Food and Drug Administration (FDA) andthe Environmental Protection Agency (EPA). The evalu-ation mainly takes into account the end product of theprocedure that is planted in the field by the farmer.Thus, only plants with transgenes permanently inte-grated into the genome are regarded as GMOs. Thecurrent US regulation has already classified a number ofcrops mutated by synthetic nucleases as non-GMOs, asle is distributed under the terms of the Creative Commons Attribution 4.0.org/licenses/by/4.0/), which permits unrestricted use, distribution, andive appropriate credit to the original author(s) and the source, provide a link tochanges were made. The Creative Commons Public Domain Dedication waiverro/1.0/) applies to the data made available in this article, unless otherwise stated.Wolter and Puchta Genome Biology  (2017) 18:43 Page 2 of 3they contain an induced mutation but no transgene [5].In contrast, in Europe, EU legislation defines GM cropsspecifically as “an organism (…) in which the geneticmaterial has been altered in a way that does not occurnaturally by mating and/or natural recombination”.Here, the process is also relevant, as GMO-critical orga-nizations argue that any recombinant nucleic acid, evenif only transiently applied or outcrossed from the prod-uct before planting, defines the respective plant as GMOeven in the absence of the transgene in the end product.This interpretation is fortunately not generally acceptedwithin the member states. Interestingly, at the end of2015, the Swedish Board of Agriculture (Sweden is partof the EU) confirmed the interpretation that some plantswhich have had their genomes edited using CRISPR/Cas9 technology do not fall under the European GMOdefinition. Nevertheless, due to public concerns, a re-strictive interpretation of process principle might be-come an important hurdle in the future for the use ofgene-edited plants within the EU, although such a regu-lation would never be experimentally verifiable. As thedecision of the EU might be a guiding light for a numberof other nations, such a decision would have worldwideconsequences.To avoid such risks, the idea arose to modifygenome-editing approaches in such a way that thesynthetic nuclease is not expressed in the transformedcell from a recombined nucleic acid, but is deliveredin its active form similar to chemical mutagens inclassic breeding. Therefore, plants where mutationsare induced by proteins such as synthetic nucleasesor RNPs, for example Cas9, should not fall under thecurrent EU regulation and qualify the respectiveplants as non-GMOs.DNA-free genome editing in wheat and maizeestablishedDue to the presence of the cell wall, efficient delivery ofgenome-editing reagents into intact plant cells is mainlylimited to two methods: Agrobacterium-mediated deliv-ery of transfer DNA (T-DNA) and biolistic delivery ofplasmid DNA. In both cases, the delivered DNA fre-quently integrates into the plant genome. Now, two re-cent pioneering studies have demonstrated the potentialof the idea to edit plant genomes without introducingforeign DNA. The group of Caixia Gao from the ChineseAcademy of Science in Beijing had already shown that itis possible to achieve a high rate of edited plants withouttransgene integration if the use of selectable markers isomitted [8]. In this approach, they delivered Cas9 andsgRNA on DNA vectors without selectable markers intoimmature wheat embryos via particle bombardment.Plants were regenerated without selective agents within6–8 weeks, which is a significantly shorter time periodthan earlier protocols using selective agents [9]. Mutantanalysis revealed that more than half of the regeneratedmutant plants contained no transgene. They furtherdemonstrated that Cas9 and sgRNA can be transcribedin vitro and delivered in the form of RNA. Since RNAcannot integrate into the genome, the obtained mutantsare transgene-free, but mutagenesis efficiency was lowerwhen RNA was delivered.More recently, the same group expressed Cas9 inEscherichia coli and pre-assembled it with in vitrotranscribed guide RNAs targeting two different wheatgenes [2]. After functional validation of these RNPs inprotoplasts, they were delivered into immature em-bryo cells of wheat via particle bombardment. Again,plantlets were regenerated from bombarded embryoswithout the use of any selective agents within 6–8weeks (Fig. 1). While on-target mutagenesis of RNPdelivery (up to 4.4% of regenerated plantlets showedtarget mutations) was comparable to DNA delivery,mutagenesis at an off-target site harbouring a singlenucleotide mismatch was considerably reduced. Incontrast, conventional DNA delivery led to mutagen-esis at the off-target site that was comparable to on-target mutagenesis.The group of Mark Cigan from DuPont Pioneer,Johnston USA, performed similar experiments inmaize [1]. They delivered pre-assembled RNPs target-ing four different genes into immature embryo cellsvia particle bombardment. Again, plants were regen-erated without selectable markers and, depending onthe target, 2.4–9.7% of plants showed mutated alleles.Notably, not a single regenerated plant showed muta-tions at an off-target site harbouring two PAM distalmismatches. Just as in wheat, off-target mutationswere only detectable by amplicon deep sequencing ofbombarded embryos. In maize, RNP delivery also en-abled homologous recombination (HR)-mediated pre-cise gene editing of the endogenous ALS2 when a127-bp single-stranded repair template for HR wasco-delivered. This demonstrates the much broaderapplicability of RNP delivery than mere genedisruption.In addition to the discussed benefits concerning legalregulation, this new technology has two additional ad-vantages. First, off-site effects were drastically reducedcompared with conventional DNA delivery, which isclearly beneficial for the development of new crop var-ieties. Second, when DNA is integrated into the genomein the breeding process it needs to be segregated awayby backcrossing. However, this can be quite time con-suming in the case of crops such as wheat and maizewith complex genomes and/or long breeding cycles. Thisadditional effort can be safely omitted with this new ex-citing technology.In vitro transcribed sgRNACas9 purifiedfrom E. coliParticle coatingComplexassemblyCTGATCGCGTTAACGTGTCTAGGCTGATCGCGTTAACGT_TCTAGGCTGATCGCGTTAACGTG_CTAGGCTGATCGCGTTAACGTGATCTAGGWheat embryo bombardmentMarker free regenerationMutant screeningFig. 1 Workflow used by Liang et al. [2] to achieve DNA-freeediting of wheat genes. Cas9 is expressed in E. coli and purified.Single guide RNA (sgRNA) is transcribed in vitro and complexedwith Cas9. This complex is coated onto 0.6 μm gold particleswhich are then bombarded into immature wheat embryo cells.Plants are regenerated without any selective agent from bombardedembryos and screened for mutations via PCR/restriction enzyme assayand sequencingWolter and Puchta Genome Biology  (2017) 18:43 Page 3 of 3Closing remarksWe will only be able to address challenges of the world,including ensuring sufficient food supply, if we evaluatenewly developed technologies for their risk potential andtheir sustainability in a rational way. Hopefully, the twopublications discussed here will help to achieve this goaland make the CRISPR/Cas technology more accessiblefor use in agriculture all over the globe.AbbreviationsGMO: Genetically modified organism; RNP: Ribonucleoprotein; sgRNA: Singleguide RNAFundingThis work on genome engineering in our group is funded by the EuropeanResearch Council, the BMBF and the DFG.Authors’ contributionsFW and HP both wrote and edited the manuscript. Both authors read andapproved the final manuscript.Competing interestsThe authors declare that they have no competing interests.References1. Svitashev S, Schwartz C, Lenderts B, Young JK, Mark Cigan A. Genomeediting in maize directed by CRISPR–Cas9 ribonucleoprotein complexes. NatCommun. 2016;7:13274. doi:10.1038/ncomms13274.2. Liang Z, Chen K, Li T, Zhang Y, Wang Y, Zhao Q, et al. Efficient DNA-freegenome editing of bread wheat using CRISPR/Cas9 ribonucleoproteincomplexes. Nat Commun. 2017;8:14261. doi:10.1038/ncomms14261.3. Schiml S, Puchta H. Revolutionizing plant biology: multiple ways ofgenome engineering by CRISPR/Cas. Plant Methods. 2016;12:8. doi:10.1186/s13007-016-0103-0.4. Hilscher J, Burstmayr H, Stoger E. Targeted modification of plant genomesfor precision crop breeding. Biotechnol J. 2017. doi:10.1002/biot.201600173.5. Pacher M, Puchta H. From classical mutagenesis to nuclease-basedbreeding–directing natural DNA repair for a natural end-product. Plant J.2016. doi:10.1111/tpj.13469.6. Kim S, Kim D, Cho SW, Kim J, Kim J-S. Highly efficient RNA-guided genomeediting in human cells via delivery of purified Cas9 ribonucleoproteins.Genome Res. 2014;24:1012–9. doi:10.1101/gr.171322.113.7. Woo JW, Kim J, Kwon SI, Corvalan C, Cho SW, Kim H, et al. DNA-freegenome editing in plants with preassembled CRISPR-Cas9ribonucleoproteins. Nat Biotechnol. 2015;33:1162–4. doi:10.1038/nbt.3389.8. Zhang Y, Liang Z, Zong Y, Wang Y, Liu J, Chen K, et al. Efficient and transgene-free genome editing in wheat through transient expression of CRISPR/Cas9DNA or RNA. Nat Commun. 2016;7:12617. doi:10.1038/ncomms12617.9. Wang Y, Cheng X, Shan Q, Zhang Y, Liu J, Gao C, Qiu J-L. Simultaneousediting of three homoeoalleles in hexaploid bread wheat confers heritableresistance to powdery mildew. Nat Biotechnol. 2014;32:947–51. doi:10.1038/nbt.2969.

Knocking out consumer concerns and regulator\u27s rules: Efficient use of CRISPR/Cas ribonucleoprotein complexes for genome editing in cereals

http://dx.doi.org/10.1186/s13059-017-1179-1

Knocking out consumer concerns and regulator\u27s rules: Efficient use of CRISPR/Cas ribonucleoprotein complexes for genome editing in cereals

Abstract

Similar works

Full text

Available Versions

Springer - Publisher Connector

KITopen