A Lonvaud-Funel

C Ilabaca

C Reguant

Carla Jara

Carolina Ilabaca

E Bon

G Spano

J Romero

Jaime Romero

M Larkin

P Hugenholtz

P Ruiz

RI Amann

T Hall

V Renouf

Crossref

SHORT COMMUNICATIONThe rapid identification of lactic acid bacteria present in Chileanwinemaking processes using culture-independent analysisCarolina Ilabaca & Carla Jara & Jaime RomeroReceived: 13 August 2013 /Accepted: 9 January 2014 /Published online: 25 January 2014# The Author(s) 2014. This article is published with open access at Springerlink.comAbstract A polymerase chain reaction-restriction fragmentlength polymorphism (PCR-RFLP) analysis of 16S ribosomalRNA (rRNA) genes was developed to identify lactic acidbacteria (LAB) that are commonly present in winemakingprocesses (Oenococcus, Pediococcus, Lactobacillus, andLeuconostoc). This culture-independent approach revealedthe presence of Oenococcus in the spontaneous malolacticfermentation in industrial Chilean wines.Keywords Malolactic fermentation .Oenococcus oeni .Lactic acid bacteria .Wine . ChileIn Chile, the production of wines has sharply increased inrecent years, reaching 12.5 million hL per year (ServicioAgrícola y Ganadero, Chile 2012). In most Chilean wineries,the malolactic fermentation (MLF) stage of winemakinglargely occurs in a spontaneous manner; thus, at present,limited knowledge exists regarding the bacterial populationsinvolved in this process. MLF is an important stage impactingthe wine quality, in which lactic acid bacteria (LAB) transformmalic acid into lactic acid and CO2, decreasing the overallacidity of a wine and proving microbiological stability. Hence,this study aimed to develop a rapid molecular method todescribe LAB populations during spontaneous MLF.A succession of LAB is observed during spontaneousMLF. In particular, LAB belonging to the genera Lactobacil-lus, Leuconostoc, Oenococcus, and Pediococcus have beenfound in wine (Lonvaud-Funel 1999; Reguant and Bordons2003; Ruiz et al. 2010). Lactobacillus, Pediococcus, andLeuconostoc species gradually disappear as vinification pro-ceeds. In contrast, Oenococcus oeni becomes increasinglyapparent during the course of MLF (Spano et al. 2007). Thisdynamic of bacterial populations present during MLF hasbeen studied using culture-dependent techniques (Reguantand Bordons 2003). These bacteria grow slowly in artificialmedia; as a result, the isolation of these bacteria requires longincubation times (>5 days), and the biochemical identificationof these bacteria is tedious because it depends on the growth ofthe cultured strains. Therefore, these methods are unsuitablefor the practical monitoring of bacteria during industrial vini-fication. Furthermore, it is challenging to utilize thesemethodsto obtain an accurate picture of the dynamics of LAB duringMLF because these bacteria generally exhibit low cultivability(Amann et al. 1995; Hugenholtz et al. 1998).More recently, molecular methods based on analyzingDNA extracted from a sample (culture-independentmethods) have been employed to circumvent this issue.Renouf et al. (2006) and Spano et al. (2007) applied denatur-ing gradient gel electrophoresis (DGGE) to the analysis ofbacterial populations during MLF. This method is difficult toutilize routinely because the achievement of reproduciblegradients using DGGE requires relatively sophisticated equip-ment and trained personnel. In this work, a culture-independent analytical approach is proposed that requires onlysimple equipment and can provide rapid results regarding thecomposition of bacterial populations present during industrial-level MLF. In this method, Oenococcus, Leuconostoc,Pediococcus, and Lactobacillus bacteria are identified usingElectronic supplementary material The online version of this article(doi:10.1007/s13213-014-0810-6) contains supplementary material,which is available to authorized users.C. Ilabaca : J. Romero (*)Laboratorio de Biotecnología, Instituto de Nutrición y Tecnología delos Alimentos (INTA), Universidad de Chile, El Líbano,5524 Macul Santiago, RM, Chilee-mail: jromero@inta.clC. JaraDepartamento de Agroindustria y Enología, Facultad de CienciasAgronómicas, Universidad de Chile, Av. Santa Rosa,11315 La Pintana, Santiago, RM, ChileAnn Microbiol (2014) 64:1857–1859DOI 10.1007/s13213-014-0810-6a polymerase chain reaction-restriction fragment lengthpolymorphism (PCR-RFLP) approach that involves tworestriction enzymes. This approach allows for the simul-taneous determination of the presence or absence of thefour most prevalent winemaking LAB genera in MLFduring vinification.The design of this MLF tracking method involved approx-imately 500 bp of the 16S ribosomal RNA (rRNA) genesequences of the Oenococcus, Leuconostoc, Pediococcus,and Lactobacillus genera; in particular, numbering base pairsbased on the Escherichia coli. 16S rRNA gene, the regionbetween base pairs 341 and 788 was examined (Figure S1).These sequences were aligned with ClustalW (Larkin et al.2007) and subjected to an entropy analysis to determineregions that differentiated the examined genera. Four suchregions, located approximately at base pairs 456–461, 616–621, 651–656, and 766–771, were identified through thisanalysis; these regions are useful for using 16S rRNA geneanalysis to distinguish among these four winemaking LABgenera.The in silico design for the MLF tracking approach re-quired the identification of restriction endonucleases that rec-ognized sites within these regions. This search was performedusing the BioEdit software program, version 7.1.3 (Hall1999). Finally, two enzymes, XmnI and TspRI, were selected.The simultaneous use of both enzymes produced distinctiverestriction patterns that differentiate among the examinedwinemaking LAB. Comparing the in silico with the experi-mental restriction profiles of reference strains allowed thevalidation of the method to distinguish LAB populations.The reference strains from different collections wereOenococcus oeni JCM (Japan Collection of Microorganisms)6125; Leuconostoc mesenteroides LMG (Laboratorium voorMicrobiologie) 8159; Pediococcus parvulus NBRC (NITEBiological Research Center) 100673; and Lactobacillus brevisATCC (American Type Culture Collection) 14687. To per-form these comparisons, reference strains were grown indefined culture media, and DNAwas extracted in accordancewith Romero et al. (2002). The 16S rRNA gene was thenamplified by PCR in accordance with Ilabaca et al. (2008). Acombination of the restriction enzymes XmnI (Thermo Scien-tific) and TspRI (Thermo Scientific), which were chosen basedon the in silico analysis, was used for amplicon digestion.Amplicons were incubated with these restriction enzymes for2 h at 37 °C and 16 h at 65 °C. The obtained restriction profileswere visualized using 90 min of electrophoresis at 80 V on10 % polyacrylamide gels followed by staining with SYBRGreen (Invitrogen).The results obtained from these analyses are depicted inFig. 1. The reference strains exhibit different profiles follow-ing digestion with the tested enzymes. These restriction en-zymes, XmnI and TspRI, provide results that are easy to visu-alize. In particular, a laddered pattern of restriction fragmentsis observed, with bands appearing at approximately 300 bp forLeuconostoc, 250 bp for Oenococcus, 200 bp forLactobacillus, and 150 bp for Pediococcus. The exact sizesof the fragments are described in Table S1, it also describesthat same genus always shows the same RFLP pattern.The developed method was applied to wine samples duringtheMLF process. Spontaneous industrial MLFwas monitoredfor Vitis vinifera cv. Cabernet Sauvignon and cv. Carménère(10,000 L). Different stages of the MLF process were exam-ined: the initial stage of MLF (the iMLF lanes; this stagecoincides with the end stage of alcoholic fermentation); themiddle stage of MLF (the mMLF lanes), and the final stage ofMLF (the fMLF lanes). For Cabernet Sauvignon, the initialstage of MLF was May 7, the middle stage of MLF was Jun13, and the final stage ofMLFwas Jun 28. For Carménère, theinitial stage of MLF was May 30, the middle stage of MLFwas Jun 20, and the final stage of MLF was Jul 14. In theiMLF lanes (Fig. 1), the bands produced from samples of bothcultivars do not correspond to bands produced by the LABthat are reportedly associated with MLF. This phenomenonmay reflect the fact that only a limited LAB population ispresent during the initial stages of MLF; thus, this populationmay be below detection limits (Ruiz et al. 2010). In contrast, atthe midpoint of MLF, the mMLF lanes for the examinedcultivars exhibited bands indicative of the presence ofOenococcus. The presence of Oenococcuswas also observedduring the final stage of MLF (the fMLF lanes) for theexamined cultivars. To confirm the identity of OenococcusFig. 1 RFLP profiles derived from reference strains and illustrating theidentification of LAB during the MLF stages of the production ofCabernet Sauvignon (cs) and Carménère (car). The reference strains(Reference) correspond to Leuconostoc mesenteroides LMG 8159 (Le),Oenococcus oeni JCM 6125 (Oe), Lactobacillus brevis ATCC 14687(Lb), and Pediococcus parvulus NBRC 100673 (Pd). The analyzedsamples correspond to the following MLF stages: the initial stage (i),the middle stage (m), and the final stage (f). Ld represents theO’GeneRuler Low Range DNA Ladder1858 Ann Microbiol (2014) 64:1857–1859band, specific primers (F: GCTAAATACGTGCCAGCAGC;R: TCCACTTGCCTCTATCGCAC) were design and theband was eluted and sequenced; the resulting sequencecorresponded toOenococcuswith 100% of identity as derivedfrom Blast analysis (see Figure S2). In summary, the profilesrevealed the prevalence of Oenococcus during the MLF pro-cess, and bacteria from this genus were readily differentiablefrom the other genera involved in MLF.Based on the aforementioned results, the designed16S rRNA PCR-RFLP strategy constitutes a fast, easy,informative and reliable tool for the identification anddifferentiation of winemaking LAB strains isolated dur-ing MLF processes. The proposed approach can distin-guish among LAB genera reported to be present duringMLF (Lonvaud-Funel et al. 1991; Bon et al. 2009; Ruizet al. 2010). Consequently, the 16S rRNA PCR-RFLPapproach using XmnI and TspRI allows for the simulta-neous parallel observation of the presence or absence ofthe four genera (Oenococcus, Leuconostoc, Pediococcus,and Lactobacillus) of LAB that are most prevalent dur-ing the middle and final stage of MLF. This strategycan be used in both spontaneous MLF and MLF in-duced with commercial starter cultures. Thus, this qual-itative method allows the genera of LAB involved inspontaneous MLF to be determined. In the case of MLFinoculated with commercial starter cultures, the intro-duction of the inoculated bacteria can be controlled,and any contamination by other winemaking LABstrains, which could alter the organoleptic characteristicsof a wine, can be monitored.Acknowledgments This was funded by grants from FONDEF IdeaCA12I10123, Inserción a la Academia 791100011 and FONDECYT1121329 from CONICYT; INNOVA 12IDL2-13145 from Corfo.Open Access This article is distributed under the terms of the CreativeCommons Attribution License which permits any use, distribution, andreproduction in any medium, provided the original author(s) and thesource are credited.ReferencesAmann RI, Ludwig W, Schleifer KH (1995) Phylogenetic identificationand in situ detection of individual microbial cells without cultiva-tion. Microbiol Rev 59:143–169Bon E, Delaherche A, Bilhère E, De Daruvar A, Lonvaud-Funel A, LeMarrec C (2009) Oenococcus oeni genome plasticity is associatedwith fitness. App Environ Microbiol 75:2079–2090Hall T (1999) BioEdit: a user-friendly biological sequence alignmenteditor and analysis program for Windows 95/98/NT. Nucl AcidsSymp Series 41:95–98Hugenholtz P, Goebel BM, Pace NR (1998) Impact of culture indepen-dent studies on the emerging phylogenetic view of bacterial diver-sity. J Bacteriol 180:4765–4774Ilabaca C, Navarrete P, Mardones P, Romero J, Mas A (2008) Applicationof culture culture-independent molecular biology based methods toevaluate acetic acid bacteria diversity during vinegar processing. IntJ Food Microbiol 126:245–249Larkin M, Blackshields G, Brown NP, Chenna R, McGettigan PA,McWilliam H, Valentin F, Wallace IM, Wilm A, Lopez R,Thompson JD, Gibson TJ, Higgins DG (2007) Clustal W andClustal X version 2.0. Bioinformatics 23:2947–2948Lonvaud-Funel A, Joyeux A, Ledoux O (1991) Specific enumeration oflactic acid bacteria in fermenting grape must and wine by colonyhybridization with no- isotopic DNA probes. J Appl Bacteriol 71:501–508Lonvaud-Funel A (1999) Lactic acid bacteria in the quality improvementand depreciation of wine. J Anton Leeuw Int 76:317–331Reguant C, Bordons A (2003) Typification ofOenococcus oeni strains bymultiplex RAPD-PCR and study of population dynamics duringmalolactic fermentation. J Appl Microbiol 95:344–353Renouf V, Claisse O, Lonvaud-Funel A (2006) Lactic acid bacteriaevolution during winemaking: Use of rpoB gene as a target forPCR-DGGE analysis. Food Microbiol 23:136–145Ruiz P, Izquierdo PM, Sesena S, Palop ML (2010) Analysis of lactic acidbacteria populations during spontaneous malolactic fermentation ofTempranillo wines at five wineries during two consecutive vintages.Food Control 21:70–75Romero J, Garcia-Varela M, Laclette JP, Espejo RT (2002) Bacterial 16SrRNA gene analysis revealed that bacteria related to Arcobacter spp.constitute an abundant and common component of the oyster mi-crobiota (Tiostrea chilensis). Microbial Ecol 44:365–371ServicioAgrícola yGanadero (S.A.G.) (2012) InformeEjecutivo Producciónde Vinos Chilenos.http://www.sag.cl/sites/default/files/informe_ejecutivo_produccion_vinos_2012.pdf Accessed 26 June 2013Spano G, Lonvaud-Funel A, Claisse O, Massa S (2007) In vivo PCR-DGGE analysis of Lactobacillus plantarum and Oenococcus oenipopulations in red wine. Curr Microbiol 54:9–13Ann Microbiol (2014) 64:1857–1859 1859

Annals of Microbiology

The rapid identification of lactic acid bacteria present in Chilean winemaking processes using culture-independent analysis

https://link.springer.com/content/pdf/10.1007%2Fs13213-014-0810-6.pdf

The rapid identification of lactic acid bacteria present in Chilean winemaking processes using culture-independent analysis

Abstract

Similar works

Full text

Available Versions

Crossref