AMQ King

C Silva

D Vaškova

DJ Obbard

DT Jones

Elżbieta Kalinowska

Elżbieta Paduch-Cichal

ER Chare

F Fonseca

F García-Arenal

HA Brunt

JF Bol

JK Uyemoto

K Tamura

Karolina Mroczkowska

M Németh

Maria Chodorska

MF Clark

RD Kelley

SL Kosakovsky Pond

T Malinowski

V Pallas

V Yusibov

Ç Ulubaş

Crossref

Genetic variability among coat protein of Prune dwarf virusvariants from different countries and different Prunus speciesElżbieta Kalinowska & Karolina Mroczkowska &Elżbieta Paduch-Cichal & Maria ChodorskaAccepted: 1 August 2014 /Published online: 9 August 2014# The Author(s) 2014. This article is published with open access at Springerlink.comAbstract Prune dwarf virus (PDV) isolates have beeninvestigated for genetic diversity. Full-length nucleotideand amino acid sequences of viral coat protein from 23isolates collected from different stone fruit trees (sourand sweet cherry trees, wild cherry tree, plum tree,almond tree, peach tree) and different countries (Poland,Italy, Germany, USA, Israel) were analysed and com-pared to 57 others available in GenBank. Comparison ofall sequenced virus isolates revealed diversity of 86–100 % at nucleotide level and 79–100 % at amino acidlevel. The ratio of non-synonymous to synonymouspolymorphic sites indicated that purifying selectiondominated in case of PDV. However, six codons showedto be under strong positive selection, including the co-don located inside the structure involved in RNA-binding activity.Keywords Prune dwarf virus . PDV. Coat protein .Genetic diversityStone fruit trees are infected by several viruses, whichcause significant economic losses. One of the notablepathogens is Prune dwarf virus (PDV). PDV is distrib-uted worldwide and infects many Prunus species, in-cluding almond, sour- and sweet cherry, peach, apricot,and plum trees (Németh, 1986). Disease symptomscaused by PDV vary from no obvious to serious dam-ages resulting in significant yield and vigour reduction.Disease symptoms can be visible as chlorosis, chloroticrings and spots on the leaves (sour cherry), stunting, andleaf malformations as well as fruit size reduction(peaches, plums, and prunes) and fruit rain cracking(sweet cherries) (Uyemoto and Scott, 1992; Bruntet al., 1996). Symptoms are correlated with virus isolate,host, and climate (Németh, 1986). PDV is transmittedby grafting as well as through pollen and seeds (Kelleyand Cameron, 1986). The virus is also carried insidealmond pollen grain (Silva et al., 2003).PDV belongs to the genus Ilarvirus, familyBromoviridae (King et al., 2012). The virus genome isorganized into three plus-stranded RNAs. RNAs 1 and 2encode conservative proteins involved in viral replica-tion. RNA 3 encodes movement protein (MP) and coatprotein (CP), which is expressed via sub-genomic RNA4 (Bachman et al., 1994).Despite of differences in serological and biologicalproperties of PDV isolates a molecular characterizationof viral coat protein sequences did not reveal a correla-tion between amino acid composition and host speciesand/or origin of the viral isolate (Vaškova et al., 2000).Subsequent studies of PDV CP nucleotide sequencesrevealed higher divergence in almond isolates of PDVthan in isolates obtained from other hosts (Fonseca et al.,2005) and indicated presence of four phylogroups: 1.Eur J Plant Pathol (2014) 140:863–868DOI 10.1007/s10658-014-0502-xElectronic supplementary material The online version of thisarticle (doi:10.1007/s10658-014-0502-x) contains supplementarymaterial, which is available to authorized users.E. Kalinowska (*) :K. Mroczkowska : E. Paduch-Cichal :M. ChodorskaWarsaw University of Life Sciences, Department of PlantPathology, Nowoursynowska 159, 02-776 Warsaw, Polande-mail: elzbieta_kalinowska@sggw.plTable 1 The author’s PDV isolates (bold) and PDV sequences avaible in GenBankIsolate Original host Country of origin GenBank GI No. Phylogroup/SubgroupRS-40B/1 Cherry Hungary 45385845 IPDV-SW7 Cherry Poland 270036708Skierniewice Cherry Poland 905394PD10 Cherry Turkey 148612159PD3 Cherry Turkey 148612145PD4 Cherry Turkey 148612147B.11.15 Almond Portugal 56111823 II Acp4.3 Almond Portugal 561118213.19.A1.2 Almond Portugal 561118301.8.A3 Almond Portugal 56111828cp1.2 Almond Portugal 56111819-1 Almond Portugal 66065173.12.N.14 Almond Portugal 561118323.20.1 Almond Portugal 561118383.17.A1 Almond Portugal 561118343.20.2 Almond Portugal 56111836- Peach Argentina 11545665 II4B Almond Portugal 56111826N.1.2 Almond Portugal 56111817RS-45/1 Cherry Moldova 45385851PDV-PL13 Plum Poland 270036710PDV-SWI-35 Cherry Poland 262092717vanC Cherry Czech Republic 11494040ch137 Cherry USA 452499PDV-SW6-1 Cherry Italy 2620927232/16 Cherry Czech Republic 11494028Branisovska Plum Czech Republic 11494049PD5 Cherry Turkey 148612149PDV-Plum5 Plum Italy 270036712PDV-PL1-19 Plum Italy 262092725PDV-SW-Regina Cherry Poland 262092719PDV-SOF15P1 Cherry Italy 407908777PS7/9a Cherry Czech Republic 11494034PDV-SO14 Cherry Poland 4079087716/54 Plum Czech Republic 114940557/12 Plum Czech Republic 11494058sss Plum Czech Republic 11494052Valticka Peach Czech Republic 11494043Nem Peach Germany 11494046RS-50A/1 Wild cherry Hungary 45385847RS-88/1 Cherry Hungary 4538584910 W3 Cherry Poland 157931543K1 Cherry Czech Republic 11494031PDV-PA78 Wild cherry Poland 407908775 IIPDV-PE15-28 Peach Germany 262092733864 Eur J Plant Pathol (2014) 140:863–868mixed 2. cherry I 3. cherry II, and 4. almond (Ulubaşet al., 2009). However, when phylogenetic analysis wasbased on amino acid sequences, the results indicated thepresence of only two groups (Pallas et al., 2012).Recent studies concerning selective pressure analysisof 36 plant RNA viruses showed that CP amino acidsequences of PDV and other non-vector borne virusesare more divergent than viruses transmitted by vectors(Chare and Holmes, 2004), although it is still unknownwhich sites of PDV CP amino acid sequence are underpositive selection.Aim of this work was to compare 23 CP gene se-quences of the authors’ PDVisolates collections with 57PDV sequences from GenBank database and to performTable 1 (continued)Isolate Original host Country of origin GenBank GI No. Phylogroup/Subgroup3 W1 Cherry Poland 157931537PDV-PA63 Wild cherry Poland 40790877921/1 Cherry Czech Republic 11494037PDVSO40E50 Cherry Israel 262092729PDV-SW9-1 Cherry USA 262092721PD6 Cherry Turkey 148612151PDV-AL2 Almond Italy 262092727PDV-SW145W Wild cherry Poland 2620927154 W1 Cherry Poland 1579315392C3 Cherry Poland 157931547PD2 Cherry Turkey 148612143PD9 Cherry Turkey 148612157PDV-SWM1 Cherry Poland 407908781PD8 Cherry Turkey 148612155RS-38/1 Cherry Hungary 45385843MC1 Peach Brazil 2099441081S2 Plum Poland 1579315315C3 Cherry Poland 1579315494 M2 Apricot Poland 157931551PDV-SOF15P11 Cherry Italy 407908777PD7 Cherry Turkey 148612153PD1 Apricot Turkey 148612141RS-10/4 Cherry Hungary 45331567PDV-Almond2 Almond Italy 270036704PDV-SOF17P17 Cherry Italy 407908773PDV-PE247 Peach Poland 407908783DJ1.2 Wild cherry China 343129302PDV-SO20SZ1 Cherry Poland 262092711PDV-SO20SZ3 Cherry Poland 2620927139 M1 Apricot Poland 1579315555 M4 Apricot Poland 1579315531C3 Cherry Poland 1579315458 W2 Cherry Poland 1579315412S1 Plum Poland 1579315333B9 Peach Poland 1579315351Dashes indicate lack of dataEur J Plant Pathol (2014) 140:863–868 865a phylogenetic analysis of PDV CP genes in order tofind motifs that are characteristic for each group/sub-group. The second goal of the study was to calculate theratio of non-synonymous and synonymous substitutionsamong the CP gene to determine how selective pressureshapes the amino acid sequence of the PDV populationand determine which sites exactly are under positiveselective pressure.The PDV isolates were collected from various geo-graphic regions and different Prunus species (Table 1).Dormant buds from different Prunus species infectedwith PDV were transferred to Prunus avium (wild cher-ry) clone F12/1 seedlings using the chip budding tech-nique. To confirm the presence of the virus, each wildcherry clone F12/1 plant was tested by DAS-ELISAusing a PDV commercial polyclonal antiserum (LoeweBiochemica GmbH, Germany) according to the proce-dure by Clark and Adams (1977). In the followingexaminations, buds and leaves from wild cherry cloneF12/1 collection were used as a source of the virus.Immunocapture reverse transcription polymerasechain reaction (IC-RT-PCR) was conducted accordingto Malinowski (2005). To amplify the complete se-quence of the CP gene, a primer pair designed byVaškova et al. (2000) (GTGTAGAAAGAAGAGAAGTCCGACAAG and ATCTAGAAGCAGCATTTCCAACTACGA) was used for one step RT-PCR (One TubeRT-PCR System; Roche, Germany).Sequences were analysed with the blastn and blastpprograms (http://www.ncbi.nlm.nih.gov/BLAST).Alignments, sequence diversity, and phylogenetic treewere made using MEGA6 (Tamura et al., 2013). Thenumber and ratio of nonsynonymous (dN) and synony-mous (dS) substitutions for each codon were estimatedon the Datamonkey server (Kosakovsky and Frost,2005), at http://www.datamonkey.org/, using therandom effects likelihood (REL) model, single likeli-hood ancestor counting (SLAC), and fixed effects like-lihood (FEL). Only codons with evidence of selectionby all three models were mentioned. Since recombina-tion can have effects on phylogenetic analysis,concatenated sequences of the PDV CP genes wereexamined for recombination using the SPB (SingleBreakpoint Recombination) and GARD (Genetic Algo-r i thm Recombina t ion Detec t ion) programs(Kosakovsky et al., 2006). Phylogenetic examinationswere repeated using SPB and GARD trees. For SLACand FEL, p-value was 0.1 and the REL Bayes Factorwas 50.The multiple alignment of PDV isolates revealedsequence identity among 23 studies’ sequences rangingfrom 87–100 % at nucleotide level and 83–100 % atamino acid level. Similar ranges were obtained whensequences were compared with corresponding se-quences available in GenBank. The percentage of iden-tity among all nucleotide sequences encoding viral coatprotein was from 86–100 %. Comparisons of CP aminoacid sequences revealed a lower percentage of identityranging from 79–100 %.Coat proteins of alfamo- and ilarviruses play animportant role in the initiation and propagation of infec-tion (Bol, 1999). One arginine located in the N thermalpart of CP is fundamental in RNA-binding activity(Yusibov and Loesch-Fries, 1998). In the case of PDV,the crucial arginine is located at position 14 of the RNA-binding consensus sequence (Q/K/R-P/N-T-X-RS-R/Q-Q/N/S-W/F-A) (Pallas et al., 2013).The amino acid alignment of 80 PDV isolates re-vealed substitution of R16/Q16 amino acids by K16 inone sequence (GI45331567). Additional replacementsTable 2 Evidence of positive selection among CP of PDV calculated using SLAC, REL and FELmethodologies (dN-dS values). For SLACand FEL significance level was at 0.1 (p-values), for REL significance level was at 50 (Bayes Factor)Codon SLAC FEL RELdN-dS p-value dN-dS p-value dN-dS Bayes Factor6 4.294 0.011 1.960 0.011 0.717 246.52513 2.730 0.017 1.176 0.001 1.376 9823.45036 2.129 0.070 0.951 0.028 1.152 208.54248 3.965 0.004 1.758 0.001 1.336 12805.40097 3.276 0.019 1.369 0.017 1.100 1791.800126 1.969 0.090 0.876 0.027 1.091 155.442866 Eur J Plant Pathol (2014) 140:863–868were present at Q17/N17/S17 positions; in two sequences,these amino acids were changed to R17 (GI407908779)and G17, (GI56111838). In two other sequences(GI262092711, GI262092713), the position A19 wasreplaced by S19.A phylogenetic tree of PDV CP amino acid se-quences was made using the maximum likelihood meth-od based on the JTT model (Jones et al., 1992). The treeconstructed separated all PDV isolates analysed into twoclades (Supplementary material - Fig. 1). The first group(phylogroup I) contained all isolates from ‘cherry Igroup’ described by Ulubaş et al. (2009). Sequencesimilarity within the phylogroup I was between 89–99 % at nucleotide level and 94-99 % at amino acidlevel. The second group (phylogroup II) included 73 ofthe 80 analysed isolates and contained one almondsubgroup (subgroup A). Sequence similarity within thephylogroup II was between 86–100 % at nucleotidelevel and 79–100 % at amino acid level. There was noobvious correlation between coat protein sequence andgeographic origin of the isolates confirming earlier stud-ies (Vaškova et al., 2000; Fonseca et al., 2005; Ulubaşet al., 2009). Analysis of PDV CP amino acid alignmentdid not reveal any characteristic motifs in any of the twogroups except the presence of V at position 38 and S atposition 186 in the first cluster.The CP genes of 80 PDV isolates were initiallyanalysed for recombination using GARD and SBPmethods. Although the GARD algorithm did not findrecombination events in the analysed data set, the SBPalgorithm revealed a recombination point at the 574nucleotide in the CP PDV alignment using Akaike In-formation Criterion (AIC), with 100 % of the modelaverage support. It is known that maximum likelihoodmethods of the codon substitution model used to esti-mate sites under positive selection may generate falsepositive results when recombination is not taken intoaccount. For this reason, SBP inferred trees were used infurther analysis. The results of SLAC, REL, and FELestimations revealed that purifying selective pressuredominates in the case of PDV coat protein. All methodsestimated strong signals of negative selection for 56sites, including codons (bold) inside the Q/K/R-P/N-T-X-RS-R/Q-Q/N/S-W/F-A structure. Our result meetswith the hypothesis concerning domination of the puri-fying selection as one of the ways to remove deleteriousmutations (García-Arenal et al., 2001). Despite domina-tion of the purifying selective pressure, our estimationsrevealed that 2.73 % of codons (6, 13, 36, 48, 97, and126) were under significant positive selection (Table 2),including codon 13 located at position X (bold) in theQ/K/R-P/N-T-X-RS-R/Q-Q/N/S-W/F-A context. Themean dN/dS value calculated with SLAC method was0.314 and the mean pairwise diversity was 0.114. Pre-vious results of selective pressure analysis of PDV CPrevealed a mean dN/dS of 0.227 and a mean pairwisegenetic diversity of 0.032 (Chare and Holmes, 2004).Lower values obtained by Chare and Holmes (2004)may be connected with a smaller dataset available inpublic databases. Despite differences between estima-tions, our results meet with the hypothesis that thepresence of positive selection in viral populations isconnected with the mode of virus transmission and coatproteins of non-vector borne viruses are more tolerant tosequence variability than CP of vector borne viruses(García-Arenal et al., 2001; Chare and Holmes, 2004).The presence of sites with diversifying selective pres-sure in viral coat protein may also be connected withchanges in host-plant interaction, e.g., gene silencing.Viral gene silencing suppressors may be located in theCP genes (e.g., citrus tristeza closterovirus). An analysisof selective pressure among genes from 17 ssRNA plantviruses revealed dN/dS ratios for silencing suppressors,suggesting that diversifying selection may be a viralrespones to plant defense (Obbard et al., 2009).Acknowledgments This work was supported by grant fromthe Polish Ministry of Science and Higher Education (GrantNo. N310 0247 33).Open Access This article is distributed under the terms of theCreative Commons Attribution License which permits any use,distribution, and reproduction in any medium, provided the orig-inal author(s) and the source are credited.ReferencesBachman, E. J., Scott, S. W., Xin, G., et al. (1994). The completenucleotide sequence of Prune dwarf ilarvirus RNA3: impli-cations for coat protein activation of genome replication inilarviruses. Virology, 201, 127–13.Bol, J. F. (1999). Alfalfa mosaic virus and ilarviruses: Involvementof coat protein in multiple steps of the replication cycle.Journal of General Virology, 80, 1089–1102.Brunt, H. A., Crabtree, K., Dallawitz, M. J., et al. (1996). Virusesof Plants. Wallingford: CAB International.Eur J Plant Pathol (2014) 140:863–868 867Chare, E. R., & Holmes, E. C. (2004). Selection pressures in thecapsid genes of plant RNA viruses reflect mode of transmis-sion. Journal of General Virology, 85, 3149–3157.Clark, M. F., & Adams, A. N. (1977). Characteristics of themicroplate method of enzyme-linked immunosorbent assayfor the detection of plant viruses. Journal of GeneralVirology, 34, 475–483.Fonseca, F., Neto, J. D., Martins, V., et al. (2005). Genomicvariability of Prune dwarf virus as affected by agriculturalpractice. Archives of Virology, 150, 1607–1619.García-Arenal, F., Fraile, M., & Malpica, J. M. (2001). Variabilityand genetic structure of plant virus populations. AnnualReview of Phytopathology, 39, 157–186.Jones, D. T., Taylor, W. R., & Thornton, J. M. (1992). The rapidgeneration of mutation data matrices from protein sequences.Computer Applications in the Biosciences, 8, 275–282.Kelley, R. D., & Cameron, H. R. (1986). Location of Prune dwarfand Prunus necrotic ringspot viruses associated with sweetcherry pollen and seed. Phytopathology, 76, 317–322.King, A. M. Q., Adams, M. J., Carstens, E. B., et al. (2012). Virustaxonomy: Classification and nomenclature of viruses: Ninthreport of the international committee on taxonomy of viruses.San Diego: Elsevier Academic Press.Kosakovsky Pond, S. L., & Frost, S. D. W. (2005). Datamonkey:Rapid detection of selective pressures on individual sites ofcodon alignments. Bioinformatics, 21, 2531–2533.Kosakovsky Pond, S. L., Posada, D., Gravenor, M. B., et al.(2006). Automated phylogenetic detection of recombinationusing a genetic algorithm.Molecular Biology and Evolution,23, 1891–1901.Malinowski, T. (2005). Potential problems with the reliability ofPCR based diagnostic methods related to plant viruses se-quence variation. Phytopathologia Polonica, 35, 125–139.Németh, M. (1986). Virus, mycoplasma and rickettsia diseases offruit trees. Dordrecht: Martinus Nijhoff Publishers.Obbard, D. J., Gordon, K. H. J., Buck, A. H., et al. (2009). Theevolution of RNAi as a defence against viruses and transpos-able elements. Philosophical Transactions of the RoyalSociety, B: Biological Sciences, 364, 99–115.Pallas, V., Aparicio, F., Herranz, M. C., et al. (2012). Ilarviruses ofPrunus spp.: A continued concern for fruit trees.Phytopathology, 102, 1108–1120.Pallas, V., Aparicio, F., Herranz, M. C., et al. (2013). The molec-ular biology of ilarviruses. Advances in Virus Research, 87,139–183.Silva, C., Tereso, S., Nolasco, G., et al. (2003). Cellular location ofprune dwarf virus in almond sections by In situ reversetranscription-polymerase chain reaction. Phytopathology,93, 278–285.Tamura, K., Stecher, G., Peterson, D., et al. (2013).MEGA6: Molecular evolutionary genetics analysis ver-sion 6.0. Molecular Biology and Evolution, 30, 2725–2729.Ulubaş, Ç., Ertunç, F., & Öztrük, A. (2009). Identification andgenomic variability of prune dwarf virus variants infectingstone fruit trees in Turkey. Journal of Phytopathology, 157,298–305.Uyemoto, J. K., & Scott, S.W. (1992). Important viruses and graft-transmissible pathogens of stone fruit and nut trees inCalifornia and South Carolina. Plant Disease, 76, 5–11.Vaškova, D., Pertzik, K., & Špak, J. (2000). Molecular variabilityof the capsid protein of the prune dwarf virus. EuropeanJournal of Plant Pathology, 106, 573–580.Yusibov, V., & Loesch-Fries, L. S. (1998). Functional significanceof three basic N-terminal amino acids of alfalfa mosaic viruscoat protein. Virology, 242, 1–5.868 Eur J Plant Pathol (2014) 140:863–868

European Journal of Plant Pathology

Genetic variability among coat protein of Prune dwarf virus variants from different countries and different Prunus species

https://link.springer.com/content/pdf/10.1007%2Fs10658-014-0502-x.pdf

Genetic variability among coat protein of Prune dwarf virus variants from different countries and different Prunus species

Abstract

Similar works

Full text

Available Versions

Crossref