C. Gorni

C. Renieri

D. Meggiolaro

M. Cicogna

M. Marilli

P. Crepaldi

AIR Universita degli studi di Milano

Full Terms & Conditions of access and use can be found athttp://www.tandfonline.com/action/journalInformation?journalCode=tjas20Download by: [93.41.31.123] Date: 26 February 2017, At: 06:16Italian Journal of Animal ScienceISSN: (Print) 1828-051X (Online) Journal homepage: http://www.tandfonline.com/loi/tjas20Preliminary study on MC1R polymorphism in somecattle breeds raised in ItalyP. Crepaldi, M. Marilli, C. Gorni, D. Meggiolaro, M. Cicogna & C. RenieriTo cite this article: P. Crepaldi, M. Marilli, C. Gorni, D. Meggiolaro, M. Cicogna & C. Renieri (2003)Preliminary study on MC1R polymorphism in some cattle breeds raised in Italy, Italian Journal ofAnimal Science, 2:sup1, 13-15To link to this article:  http://dx.doi.org/10.4081/ijas.2003.11675899© 2003 Taylor & Francis Group LLCPublished online: 07 Mar 2016.Submit your article to this journal Article views: 12View related articles Preliminary study on MC1R polymorphism in some cattle breeds raised in ItalyP. Crepaldi1, M. Marilli1, C. Gorni2, D. Meggiolaro1,M. Cicogna1, C. Renieri31 Istituto di Zootecnia Generale – Università di Milano, Italy.2 Istituto di Zootecnica – Università del S. Cuore, sede di Piacenza, Italy. 3 Dipartimento di Scienze Veterinarie – Università di Camerino, Italy.RIASSUNTO – Ricerche preliminari sul polimorfismo del gene MC1R in alcune razze bovine alle-vate in Italia – Il gene MC1R è stato analizzato in 193 soggetti appartenenti a 8 razze bovine, tramitePCR, per la presenza di due mutazioni ad effetto fenotipico noto sulla pigmentazione del mantello: la dele-zione G310 e la sostituzione T296C, associate rispettivamente al fenotipo feomelanico (e) ed eumelaniconero (Ed). Sessanta soggetti di razza Limousine e Pezzata Rossa Italiana presentano genotipo e/e; 27 sog-getti di razza Frisona Italiana mostrano genotipo Ed/Ed mentre 2 genotipo Ed/e. Gli 84 soggetti apparte-nenti alle razze Cabannina, Chianina, Marchigiana e Piemontese non presentano tali mutazioni, analo-gamente a 18 soggetti di razza Romagnola, nella quale però si sono anche osservati 2 soggetti portatoridell’allele e allo stato eterozigote.KEY WORDS: cattle, coat colour, MC1R.INTRODUCTION – Most of the Western European cattle breeds consist of standardised breeds witha definite coat colour (Renieri et al., 1984). Thus coat colour could be useful to detect genetic markers forcattle breed identification. In cattle the pigmentation is determined by the distribution of two pigments:eu- and pheomelanin, producing brown or black and red to yellow pigmentation respectively. Tyrosinase,the rate-limiting enzyme involved in the synthesis of both melanins, is regulated by the melanocyte stim-ulating hormone (αMSH). This hormone and several other melanotropic peptides stimulate melanin for-mation in melanocytes by binding to the melanocortin-1-receptor (MC1R), a G-protein-coupled receptorencoded by the Extension gene (Robbins et al., 1993). In addition, the amounts of eu- and pheomelaninin the melanocyte are controlled by the agouti gene encoding the Agouti Signal Protein (ASP), that actsas an antagonist of MSH signalling through the MC1R, even if its mechanism of action is controversial(Furumura et al., 1998). At the MC1R locus 3 principal alleles have been described (Klungland et al.,1995): the wild type E+ encodes the normal functional receptor for MSH, the dominant Ed due to a T/Csubstitution which changes the 99th amino acid to proline, leading to a MC1 receptor constitutivelyexpressed, with high levels of eumelanin production. Finally the e allele contains a G-deletion whichgives rise to a non-functional receptor and hence to low level of tyrosinase resulting in pheomelanin pro-duction. Recent studies on MC1R gene in cattle describe the presence of other 4 mutations(Graphodatskaya et al., 2000; Rouzard et al., 2000; Maudet and Taberlet, 2002). The aim of this researchis to study the MC1R polymorphism in 8 cattle breeds raised in Italy. The study concerns only the twomutations Ed and e, resulting in a clear coat colour phenotype: the black eumelanic and the pheomelan-ic respectively.MATERIAL AND METHODS – We analysed with two PCR-RFLP protocols the DNA of 193 ani-mals belonging to Italian Holstein, Pezzata Rossa Italiana (PRI), Limousine, Cabannina, Chianina,ITAL.J.ANIM.SCI. VOL. 2 (SUPPL. 1), 13-15, 2003 13* ASPA - Atti corretti  27-12-2005  16:20  Pagina 13Marchigiana, Piemontese and Romagnola breeds, to detect the G310 deletion (e allele) and the T296Csubstitution (Ed allele), amplifying two regions of MC1R gene corresponding respectively to positions193-593 and 192-329 (sequence accession number U39469). The primers used to amplify the first regionof 401 bp were designed by means of Primer3 software, while the primers designed by Klungland et al.(1995) were used for the second region of 138 bp. Polymerase Chain Reactions (PCRs) of DNA samples,were accomplished in a i-Cycler (Biorad), by using the following primers and annealing temperatures:M1 5’ AAGAACCGCAACCTGCACT 3’M2 5’ GCTATGAAGAGGCCAACGAG 3’, 62°C;E5 5’ CAAGAACCGCAACCTGCACT 3’E6 5’ GCCTGGGTGGCCAGGACA 3’, 63°C.The first 401 bp region amplified and purified was digested with MspI endonuclease. The deletion ofguanine induces the removal of MspI restriction site leading to a 401 bp fragment; the absence of muta-tion produces two fragments, 116 and 285 bp long. The second region of 138 bp amplified and purified wasdigested with AciI endonuclease. The presence of the T296C substitution creates a new restriction sitewith the production of three short fragments of 8, 33 and 97 bp; the absence of mutation produces two frag-ments of 8 and 130 bp. The first MC1R region was sequenced by M-Medical in 9 animals of 4 breeds.RESULTS AND CONCLUSIONS – The coat colour phenotypes of the considered breeds, accordingto Renieri et al. (1984), and the PCR-RFLP results for the e and Ed allele are showed in Table 1; theabsence of these two mutations is indicated by the symbol E+. The G310 deletion, corresponding to the eallele, has been observed at the homozygous state in all PRI and Limousine animals. Also 2 ItalianHolstein and 2 Romagnola carried the e allele but at the heterozygous state. The T/C substitution at 296nucleotide, corresponding to the Ed allele, has been observed only in the Italian Holstein breed. All theanimals of this breed carry this allele: 27 out of 29 are homozigous for Ed. In some previous studies therecessive e allele has not been observed in a sample of 87 and 32 Holstein individuals (Rouzard et al.,2000; Maudet and Taberlet, 2002). In 4 over the 5 other Italian breeds with the same pigmentation pat-terns, pheomelanic with eumelanic extremities, no one of these two mutations has been observed. Onlyin the Romagnola breed we found also the e allele at the heterozygous state in 2 animals. In small sam-ples of Marchigiana, Chianina and Piemontese breed another T/C substitution in position 667 has beenreported by Maudet and Taberlet (2002).Table 1. Observed genotypes in 8 cattle breeds.Breeds Coat colour phenotypes Animals Genotypes No. sample(no.) sequenced PRI blazed spotted pheom. 23 23 e/eLimousine solid pheomelanic 37 37 e/eItalian spotted eum. black 29 27 Ed/Ed 2Holstein 2 Ed/e 2Cabannina pheom. with eum. extremities 20 20 E+/E+Chianina pheom. with eum. extremities 20 20 E+/E+ 1Marchigiana pheom. with eum. extremities 20 20 E+/E+Piemontese pheom. with eum. extremities 24 24 E+/E+ 3Romagnola pheom. with eum. extremities 20 18 E+/E+2 E+/e 1eum.= eumelanic; pheom. = pheomelanic.PROC. 15th CONGR. A.S.P.A., PARMA, ITALY14 ITAL.J.ANIM.SCI. VOL. 2 (SUPPL. 1), 13-15, 2003* ASPA - Atti corretti  27-12-2005  16:20  Pagina 14The results of this work suggest that the principal polymorphisms at MC1R locus could be useful formeat or milk traceability of Holstein, Limousine and PRI breeds. Chung et al. (2000) have already sug-gested the use of MC1R gene as breed-specific DNA marker to distinguish between the meat of a Koreanpheomelanic breed (Hanwoo) and Holstein and Angus breeds, carrying the Ed allele. Also Maudet andTaberlet (2002) proposed a COP-PCR to detect Holstein’s milk in French Registered Designation ofOrigin cheese, based on Ed allele detection. To find genetic markers for cattle breed characterisation ofthe other studied Italian breeds, other loci involved in coat colour should be analysed. It is worth notingthe importance of the phenotypic coat colour description and classification of the sampled cattle to iden-tify the involved loci and to better understand the results of molecular genetic analysis.ACKNOWLEDGEMENTS – The authors are grateful to Breeder Associations for the provided bloodsamples. Research financied by FIRST 2001, Project Giovani Ricercatori 2000 (MURST) and EmiliaRomagna Region: Project “Valorizzazione della razza bovina Romagnola attraverso la certificazione dellacarne per via molecolare”.REFERENCES – Chung, E.R., Kim, W.T., Kim, Y.S., Han, S.K., 2000. Korean J. An. Sci. 42:379-390.Furumura, M., Sakai, C., Potterf, S.B., Vieira, W.D., Barsh, G.S., Hearing, V.J., 1998. Proc. Nat. Acad. Sci.95:7374-7378. Graphodatskaya, D., Joerg, H., Stranzinger, G., 2000. Veterinarni Medicina45,10/11:290-295. Klungland, H., Vage, D.I., Gomez-Raya, L., Adalsteisson, S., Lien, S., 1995.Mammalian Genome 6:636-639. Maudet, C., Taberlet, P., 2002. J. Dairy Sci. 85:707-715. Renieri, C.,Lauvergne, J.J., Valfrè, F., 1984. Riv. Zoot. Vet. 12, 5:310-317. Robbins, L.S., Nadeau, J.H., Johnson, K.R.,Kelly, M.A., Roselli-Rehfuss, L., Baack, E., Mountjoy, K.G., Cone, R.D., 1993. Cell 72:827-834. Rouzard,F., Martin, J., Gallet, P.F., Delourme, D., Goulemot-Leger, V., Amigues, Y., Menissier, F., Leveziel, H.,Julien, R., Oulmouden, A., 2000. Genet. Sel. Evol. 32:511-520.PROC. 15th CONGR. A.S.P.A., PARMA, ITALYITAL.J.ANIM.SCI. VOL. 2 (SUPPL. 1), 13-15, 2003 15* ASPA - Atti corretti  27-12-2005  16:20  Pagina 15

Preliminary study on MC1R polymorphism in some cattle breeds raised in Italy

https://air.unimi.it/retrieve/handle/2434/13725/799472/Preliminary%20study%20on%20MC1R%20polymorphism%20in%20some%20cattle%20breeds%20raised%20in%20Italy.pdf

Preliminary study on MC1R polymorphism in some cattle breeds raised in Italy

Abstract

Similar works

Full text

Available Versions

AIR Universita degli studi di Milano