We have investigated the folding dynamics of Thermus thermophilus cytochrome c_(552) by time-resolved fluorescence energy transfer between the heme and each of seven site-specific fluorescent probes. We have found both an equilibrium unfolding intermediate and a distinct refolding intermediate from kinetics studies. Depending on the protein region monitored, we observed either two-state or three-state denaturation transitions. The unfolding intermediate associated with three-state folding exhibited native contacts in β-sheet and C-terminal helix regions. We probed the formation of a refolding intermediate by time-resolved fluorescence energy transfer between residue 110 and the heme using a continuous flow mixer. The intermediate ensemble, a heterogeneous mixture of compact and extended polypeptides, forms in a millisecond, substantially slower than the ∼100-μs formation of a burst-phase intermediate in cytochrome c. The surprising finding is that, unlike for cytochrome c, there is an observable folding intermediate, but no microsecond burst phase in the folding kinetics of the structurally related thermostable protein

Bouley Ford, Nicole D.

Ford, William C.

Gray, Harry B.

Keller, Gretchen E.

Winkler, Jay R.

Yamada, Seiji

Caltech Authors - Main

Supporting Information
Yamada et al. 10.1073/pnas.1221832110
SI Text
Protein Expression and Puriﬁcation. The expression plasmid for
cytochrome c552 (c552), pRSC552, was provided by Professor Kara
L. Bren (University of Rochester, Rochester, NY); pRSC552 was
prepared by cloning the chimeric DNA sequence of Thiobacillus
versutus c550 signal peptide and Thermus thermophilus c552 into
pET17b (1). The expression plasmids for cysteine variants were
prepared using the Quick Change Lightning Site-Directed Mu-
tagenesis Kit (Agilent Technology), and the resulting DNA was
sequenced by Laragen, Inc. The primers used for mutagenesis are
listed in Table S2.
Cell cultures were prepared according to the method of Naka-
jima et al. (2). Escherichia coli BL21 (DE3) cells carrying plasmids
pEC86 (3) and pRSC552 were plated on LB agar with 100 μg/mL
ampicillin and 30 μg/mL chloramphenicol. Starter cultures from
appropriate colonies were grown overnight at 37 °C, and these
cultures were used to inoculate large-scale cultures (∼9 L). The
cells were grown at 37 °C in LB medium containing ampicillin,
chloramphenicol, and an additional molar quantity of yeast ex-
tract. After ∼4–5 h incubation, the growth temperature was
changed to 30 °C, followed by incubation for ∼16–18 h. The har-
vested cells were suspended in 50 mM Tris·HCl (pH 8.0), 1 mM
phenylmethylsulfonyl ﬂuoride, 0.1 mM EDTA, containing a small
amount of DTT and sodium ascorbate (lysis buffer). The cells
were sonicated and the extracted c552 was puriﬁed as follows.
After centrifugation of the lysate, the supernatant was loaded
onto Fast Flow CM-Sepharose media (5 cm × 12.5 cm, GE
Healthcare), equilibrated with 20 mM Tris·HCl, 0.1 mM EDTA,
pH 8.0 (buffer A). After washing the column with 400 mL of lysis
buffer, c552 was eluted with 500 mL of ∼150–175 mM NaCl in
buffer A. Following buffer exchange into 5 mM sodium phos-
phate buffer (pH 7.0), c552 was further puriﬁed by ion-exchange
chromatography on a MonoS column (GE Healthcare) using
a Pharmacia AKTA Puriﬁer system. Protein was eluted with
a linear salt gradient from 0 to 200 mM NaCl in 5 mM sodium
phosphate buffer (pH 7.0) containing a small amount of sodium
ascorbate. Protein purity was conﬁrmed by electrospray ioniza-
tion (ESI) mass spectroscopy (Protein/Peptide MicroAnalytical
Laboratory at the Beckman Institute, Caltech, Pasadena, CA).
X-Ray Crystallography. Crystals of WT c552 were obtained from
a sitting drop with a reservoir solution of 44% polyethylene
glycol monomethyl ether 5000, 0.2 M imidazole-malate buffer
(pH 5.44). The reﬂection data were collected by a Rigaku Mi-
croMax-007 HF equipped with an R-Axis IV detector. The data
were processed using Rigaku Crystal Clear and the Collaborative
Computational Project, Number 4 (CCP4) suite (4). The initial
electron density map was obtained by molecular replacement
using the coordination of c552 reported previously [Protein Data
Bank (PDB) ID code 1DT1] (1) as the template. The manual
model building and reﬁnement were performed using Qoot (5)
and Refmac5 (6), respectively. Data collection and reﬁnement
statistics are shown in Table S3.
Dansyl (DNS) Labeling. Proteins were labeled with Dns following the
method of Pletneva et al. (7). The protein solution in 100 mM
sodium phosphate buffer (pH 7.0) was pretreated with 10-fold
molar excess of DTT, which was then removed from the sample
with a PD-10 desalting column (GE Healthcare), and de-
oxygenated with argon. Five- to 10-fold molar excess of 5-((((2-
iodoacetyl)amino)ethyl)amino)naphthalene-1-sulfonic acid (In-
vitrogen) was dissolved in dimethyl sulfoxide and added to the
protein solution. The reaction was allowed to proceed overnight
at 4 °C and terminated by addition of DTT. Before buffer ex-
change for chromatography, the sample was oxidized by addition
of potassium ferricyanide. Dns-labeled c552 was puriﬁed with the
MonoS column following the procedures described above. Dns
labeling was conﬁrmed by ESI mass spectroscopy (Protein/Peptide
MicroAnalytical Laboratory at the Beckman Institute, Caltech).
Denaturation Curves. Samples of 2–20 μMproteinweremeasured in
various concentration of guanidine hydrochloride (Gdn) solution
buffered with 100 mM sodium citrate (pH 3.0), except for circular
dichroism (CD) spectroscopy with 10 mM citrate buffer. Gdn
concentrations were determined by refractive indexmeasurements
(8). CD, absorbance, and ﬂuorescence data were collected using
an Aviv 62ADS spectropolarimeter (Aviv Associates), an HP8452
diode array spectrophotometer (Hewlett-Packard), and a Fluo-
rolog2 spectroﬂuorimeter (Jobin Yvon), respectively. The un-
folding curves as shown in Fig. S2 were generated from CD (222
nm), absorption (391 nm), Dns ﬂuorescence (355 and 513 nm for
excitation and emission, respectively), and WT ﬂuorescence
(tryptophan, 360 nm emission, 290 nm excitation) data using
standard procedure (9).
1. Fee JA, et al. (2000) Integrity of thermus thermophilus cytochrome c552 synthesized by
Escherichia coli cells expressing the host-speciﬁc cytochrome c maturation genes,
ccmABCDEFGH: Biochemical, spectral, and structural characterization of the recombinant
protein. Protein Sci 9(11):2074–2084.
2. Nakajima H, et al. (2008) Engineering of Thermus thermophilus cytochrome c552:
Thermally tolerant artiﬁcial peroxidase. ChemBioChem 9(18):2954–2957.
3. Arslan E, Schulz H, Zufferey R, Künzler P, Thöny-Meyer L (1998) Overproduction of the
Bradyrhizobium japonicum c-type cytochrome subunits of the cbb3 oxidase in
Escherichia coli. Biochem Biophys Res Commun 251(3):744–747.
4. Collaborative Computational Project, Number 4 (1994) The CCP4 suite: Programs for
protein crystallography. Acta Crystallogr D Biol Crystallogr 50(Pt 5):760–763.
5. Emsley P, Cowtan K (2004) Coot: Model-building tools for molecular graphics. Acta
Crystallogr D Biol Crystallogr 60(Pt 12 Pt 1):2126–2132.
6. Murshudov GN, Vagin AA, Dodson EJ (1997) Reﬁnement of macromolecular structures
by the maximum-likelihood method. Acta Crystallogr D Biol Crystallogr 53(Pt 3):
240–255.
7. Pletneva EV, Gray HB, Winkler JR (2005) Many faces of the unfolded state:
conformational heterogeneity in denatured yeast cytochrome C. J Mol Biol 345(4):
855–867.
8. Nozaki Y (1972) The preparation of guanidine hydrochloride. Methods Enzymol 26:
43–50.
9. Pace NC, Shirley BA, Thomson TF (1990) Protein Structure: A Practical Approach (IRL,
Oxford), pp 311–330.
Yamada et al. www.pnas.org/cgi/content/short/1221832110 1 of 5
Fig. S1. CD spectra of Dns c552 variants. The spectra were measured with 20 μM protein in 10 mM sodium citrate buffer (pH 3.0) at 25 °C: WT (black), Dns126
(magenta), Dns110 (blue), Dns95 (cyan), Dns76 (green), Dns59 (yellow), Dns40 (orange), and Dns6 (red).
Fig. S2. Denaturation curve of Dns c552 variants. Normalized signal of steady-state ﬂuorescence (red), heme absorbance (blue), and circular dichroism (green)
versus Gdn concentration. Fluorescence data for Dns6 are not provided because there was negligible difference between native and unfolded states.
Fig. S3. Fluorescence decay curves of Dns c552 variants upon Gdn denaturation: Gdn 0 M (black), 3 M (red), 3.5 M (yellow), 4 M (green), 4.5 M (cyan), 5 M (blue),
and 7 M (magenta).
Yamada et al. www.pnas.org/cgi/content/short/1221832110 2 of 5
Fig. S4. Gdn-induced D–A distance distribution changes for Dns6-c552. (A) Distributions of Dns–heme distances [P(rDA)] were extracted from TR ﬁtting of
ﬂuorescence decay curves (Fig. S3): Gdn 0 M (black), 3 M (red), 3.5 M (yellow), 4 M (green), 4.5 M (cyan), 5 M (blue), and 7 M (magenta). (B) Population changes
of structural conformations as a function of the Gdn concentration: native/compact (N) as blue triangle, intermediate (I) as red square, and extended (E) as
black circle.
Fig. S5. Absorption spectra of Dns110-c552 in Gdn: Gdn 0 M (blue), 3 M (red), and 7 M (black). The spectra of 4.9 μM protein were collected in 10 mM sodium
citrate buffer (pH 3) at 25 °C.
Yamada et al. www.pnas.org/cgi/content/short/1221832110 3 of 5
Table S1. Native-state distance between donor and acceptor for
Dns c552 variants
Variant Distance Cγ–Fe (Å)* rmode (Å)
† r(Å)‡ <r>rms(Å)
§
6 17.5 21 22 22
40 22.7 22 25 26
59 16.3 21 22 23
76 18.9 19 22 22
95 21.7 22 25 25
110 21.6 21 22 23
126 16.7 21 23 24
Distributions of the distance were extracted from the TR ﬁts of the FET
kinetics data (Fig. 2).
*Calculated from the crystal structure (PDB ID code 3VNW).
†Most probable value extracted from the distribution of distances between
Dns ﬂuorophore and the Fe(III) heme.
‡Mean distance given by the ﬁrst moment of the distribution.
§Root-mean-squared value derived from the secondmoment of the distribution.
Table S2. Primers for site-directed mutagenesis
Name Sequence (5′ to 3′)
C552_K6C_SEN GCGGACGGGGCCTGCATCTACGCCCAG
C552_K6C_ANS CTGGGCGTAGATGCAGGCCCCGTCCGC
C552_E40C_SEN ATCCTCGCCAAGTGCGGCGGTAGGGAG
C552_E40C_ANS CTCCCTACCGCCGCACTTGGCGAGGAT
C552_E59C_SEN CAGGGCCAGATTTGCGTCAAGGGCATG
C552_E59C_ANS CATGCCCTTGACGCAAATCTGGCCCTG
C552_K76C_SEN TTCGCCCAGCTCTGCGACGAGGAGATC
C552_K76C_ANS GATCTCCTCGTCGCAGAGCTGGGCGAA
C552_K95C_SEN TGGGGCGACGCCTGCAAGGTCAAGGGC
C552_K95C_ANS GCCCTTGACCTTGCAGGCGTCGCCCCA
C552_K110C_SEN GAGGAGGTGAAGTGCCTCCGGGCCAAG
C552_K110C_ANS CTTGGCCCGGAGGCACTTCACCTCCTC
C552_K126C_SEN CTGGCAGAGCGGTGCAAGCTCGGCCTG
C552_K126C_ANS CAGGCCGAGCTTGCACCGCTCTGCCAG
Underlined region in sequence is the mutated site. Two primers noted as
C552_XyC_SEN and C552_XyC_ANS were used for preparing each XyC vari-
ant: X (amino acid), and y (position).
Yamada et al. www.pnas.org/cgi/content/short/1221832110 4 of 5
Table S3. X-ray crystallography data collection and reﬁnement
statistics
Data collection
Space group P65
Unit cell
a, b, c (Å) 87.0, 87.0, 31.8
α, β, γ (°) 90, 90, 120
Resolution (Å) 25.7–1.97 (2.04–1.97)
Total/unique reﬂections 47,106/9,814
Redundancy 4.8 (4.8)
Completeness (%) 98.6 (98.4)
Rmerge (%) 8.8 (31.2)
I/σ(I) 9.7 (3.6)
Reﬁnement
No. of used reﬂections 9,333
R/Rfree (%) 21.3/23.2
Total no. of atoms 1,098
Protein 984
Heme 43
Water 71
B factor (Å3) 22.2
Main chain 21.2
Side chain 22.4
Water 28.6
rmsd
Bond (Å) 0.014
Angle (°) 1.28
Values in parentheses are for the highest-resolution shells.
Yamada et al. www.pnas.org/cgi/content/short/1221832110 5 of 5
