Elati, K.

Gharbi, M.

Mwacharo, Joram M.

Rekik, Mourad

Rouatbi, M.

CGSpace

 1     Population genetic analysis of Ixodes tick species and Toxoplasma gondii in Tunisia and their relationships to global populations  Khawla Elati1, Mariem Rouatbi1, Mohamed Gharbi1, Joram Mwacharo2, Mourad Rekik3  1 Laboratoire de Parasitologie, École Nationale de Médecine Vétérinaire, Université de la Manouba, 2020 Sidi Thabet, Tunisia  2 International Centre for Agricultural Research in the Dry Areas (ICARDA), c/o ILRI 5689 Addis Ababa, Ethiopia   3 International Centre for Agricultural Research in the Dry Areas (ICARDA), PO Box: 950764, Amman 11195, Jordan   Introduction/Background The Ixodes ricinus tick complex, consisting of 14 species, is widely distributed (Keirans and Needham, 1999; Xu et al., 2003). From this complex, only I. ricinus and I. inopinatus, have been reported in Tunisia (Estrada-Peña et al., 2014). Because of the high morphological similarities, these two species were previously confounded (Noureddine et al., 2011). In Africa, I ricinus has been reported only in some humid and mountainous regions in Tunisia, Algeria and Morocco (Bouattour, 2001; Walker et al., 2003). Hoogstraal et al., (1964) recorded few numbers of I ricinus in Egypt that were most likely introduced from Southern Europe by migratory birds. I ricinus is a three-host tick species. The Immature stages are collected from small mammals, lizards (Pseumodromus algirus) or on ferns (Pteridium aquilininum), while adults feed mainly on cattle and sheep. In Tunisia, the larvae and nymphs were dragged from ferns and collected from lizards between April and August (Bouattour, 2001). Adults are active between September and May (Bouattour, 2001).  There are differences in the activity dynamics of I ricinus populations found in North African countries which are probably due to differences in microclimate (temperature, humidity and rainfall) and hosts’ availability (Estrada-Peña et al., 2013). The survey proposed here aims to  2 investigate the activity dynamics of I ricinus, to identify the abiotic factors influencing its distribution and to perform a phylogenetic analysis of populations of the species found in Ain Draham forest.  Toxoplasmosis is common in sheep in Tunisia (Gharbi et al., 2013; Khayeche et al., 2013) causing reproductive complications (Blewett et al., 1982) such as embryonic death followed by absorption or expulsion of small embryos if the infection takes place early during pregnancy. A later infection can cause abortion and birth of congenitally infected lambs (Buxton and Rodger, 2007). In males, there seems to be a relation between toxoplasmosis and disturbance of the reproductive parameters. In rams, Lopes et al. (2009) showed that T. gondii-infected rams produced smaller ejaculate volumes than healthy animals. In short and as a result of its simultaneous effects in both females and males, toxoplasmosis can be a major impediment to achieving optimal reproductive efficiency in sheep.  After estimating the serological and molecular prevalence in semen of natural infection by T. gondii in rams from different regions in Tunisia and with different reproductive history, the aim of this study was to characterize this parasite genetically and through phylogenetic analysis assess the relationship between T. gondii amplicons vis-à-vis the global haplotypes archived in the NCBI database.  Methods Study area and samples Two parasitic species were targeted in this study, the Ixodes ricinus ticks and Toxoplasma gondii. Samples of Ixodes were collected from five sites in Ain Draham region in Jendouba district North-west Tunisia.   3  Figure 1: Location of Ain Draham forest (sites for tick collection) in Tunisia  The tick samples were collected monthly between September 2016 and August 2017 using the dragging technique (Tack et al., 2011). In total, 130 ticks were sampled during the study period. The tick samples were identified based on morphological characteristics following Walker et al., (2003). All the samples were stored at -20°C until analysis. The parameters of humidity and temperature were recorded using a thermo-hygrometer data logger, while slope and GPS coordinates were recorded with GPS calculator.  For T. gondii, semen samples were collected from rams of different ages and breeds in four locations viz Bou Salem (district of Jendouba), Mohamedia (district of Ben Arous), Saouaf  4 (district of Zaghouan) and Oueslatia (district of Kairouan) of Tunisia (Figure 2). Semen samples were collected using an artificial vagina in the presence of a female in oestrus. Sperm samples were kept in sterile tubes, transported immediately to the National School of Veterinary Medicine of Sidi Thabet (Tunisia) and stored at -20 °C prior to DNA extraction. Semen samples were collected between April and September 2015; this corresponds to the peak of mating activity in sheep flocks in Tunisia.    Figure 2: Districts in Tunisia where the semen samples were collected.  DNA extraction, PCR and sequencing Genomic DNA was extracted from all the tick samples using the Wizard® Genomic DNA Extraction Kit (Promega, Madison, USA) according to the manufacturer’s instructions. PCR reactions were performed in 30 l reaction volumes made up of 1X PCR buffer, 2.25 mM MgCl2, 0.8 mM dNTP, 0.5 M of each primer, and one unit Taq polymerase. The target was to amplify the mitochondrial DNA gene 16S using the following primer pairs (16S-F 5’TGCTGTGGTATTTTGACTATAC3’; 16S-R 5’CCGGTCTGAACTCAGATCAAGT3’)  5 which amplified a fragment of 444 base pairs. The PCR reactions involved the following cycling profiles; an initial denaturation at 95°C for five minutes, followed by 35 amplification cycles made up of first denaturation step at 95°C for 30 secs, annealing at 59.4 °C for 30 secs and elongation at 72 °C for 1 minute. A final elongation step at 72 °C for 15 minutes completed the PCR reactions. A total of 20 PCR products were selected and sequenced by a private service provider.  For the semen samples, DNA was also extracted using the Wizard® Genomic DNA Purification Kit (Promega, Madison, USA) according to the manufacturer's instructions. The B1 gene of T. gondii was amplified by PCR using two primers: forward B22 (5′- AACGGGCGAGTAGCACCTGAGGAGA-3′) and reverse B23 (5′- TGGGTCTACGTCGATGGCATGACAAC-3′). The PCR reaction cocktails consisted of 10X PCR buffer, 2.5 mM MgCl2, 200 µM of each dNTP, 0.6 mg BSA, 10 pmol of primers, 1U Taq polymerase, 6 µl of sample DNA and distilled water to a total volume of 25 μl. The PCR reaction profile was composed of 2 preliminary steps of 2 min at 50 °C and 6 min at 95 °C, respectively. These steps were followed by 40 cycles of 30 secs at 94 °C, 30 secs at 57 °C and 1 min at 72 °C adding 1 sec/cycle. A final elongation step of 7 min at 72 °C was performed. A total of 30 T. gondii amplicons were randomly chosen and sequenced through a private service provider. Prior to sequencing, all the PCR products were purified with the ExoASP-IT PCR Product Cleanup Reagent (ThermoFisher Scientific) according to the manufacturer’s instructions.  Sequencing reactions were performed with the DNA Engine Tetrad 2 Peltier Thermal Cycler (BIORAD) using the ABI BigDye Terminator v3.1 Cycle Sequencing Kit (Applied Biosystems), following the manufacturer’s protocol. The sequenced fragments were visualised using an ABI 3730xl DNA Analyser (Applied Biosystems). The same primers used for PCR were used for sequencing (16F and 16S R for ticks and B22 and B23 for T. gondii samples).   Data analysis All chromatograms for both Ixodes ricinus and T. gondii were visualised and edited manually to correct base calling errors using ChromasPro software (version 1.7.4). Multiple sequence alignments will be performed using MEGA6 software and the sequences will be compared with the GenBank database with BLAST. A phylogenetic tree will be established for the analyses of the relationship between Ixodes isolates/ T. gondii in Tunisia and those from the world available in NCBI database.   6 To further asses the genetic groups present in the dataset while providing support for the phylogenetic analysis, a median joining network will be constructed using the Network software version 4.6. The default values in the program will be employed in the analysis. To put the Ixodes ticks and T. gondii found in Tunisia in the context of their global cohorts, haplotypes representing the two species will be downloaded from the NCBI’s GeneBank database and incorporated in the phylogenetic and median joining network analysis.  Expected results  1. Determination of the genetic diversity of the Ixodes ticks and the T. gondii in Tunisia. 2. Evaluation of the genetic structure and variation inherent in the Ixodes ticks and T. gondiii populations. 3. Evaluation of the genetic relationships between Ixodes ticks and T. gondii found in Tunisia with respect to others found across the world. 4. Evaluation of the correlation between the density of Ixodes ricinus population and abiotic factors (Humidity, temperature, rainfall). 5.  Construction of a phylogenetic tree in order to assess the relationship between Ixodes isolates from Ain Draham region and T. gondii amplicons from different regions in Tunisia vis-à-vis the global haplotypes available in NCBI database.  Output The genetic analysis output of this work will be incorporated in at least two papers under preparation.  References  Bouattour, A., 2001. Les tiques de Tunisie: rôle de Hyalomma detritum dans la transmission de Theileria annulata. Th Doc Es Sci Nat 247. Blewett, D.A., Teale, A.J., Miller, J.K., Scott, G.R., Buxton, D., 1982. Toxoplasmosis in rams: possible significance of venereal transmission.Vet Rec. 111, 73–75. Buxton, D., Rodger, S.M., 2007. Toxoplasmosis and neosporosis, in: Aitken, I.D. (Eds). Diseases of Sheep, fourth ed. Blackwell, Oxford, pp. 112–119. Gharbi, M., Zribi, L., Jedidi, M., Chakkhari, H., Hamdi, S., R’hayem, S.S., Zribi, N., Souli, M., Darghouth, M.A., 2013. Prevalence of Toxoplasma gondii infection in Tunisian sheep. Bull. Société Pathol. Exot. 106, 184–187.   7 Khayeche, M., Mhadhbi, M., Gharbi, M., Nasfi, I., Darghouth, M.A., 2013. Detection of Toxoplasma gondii infection of sheep slaughtered in the governorate of Sousse on the occasion of the Muslim sacrifice feast (Eid Al-Adha) and analysis of risk factors. Société Pathol. Exot. 107, 60–63.  Lopes, W.D., da Costa, A.J., Santana, L.F., dos Santos, R.S., Rossanese, W.M., Lopes, W.C., Costa, G.H.N., Sakamoto, C.A., dos Santos, T.R., 2009. Aspects of Toxoplasma Infection on the reproductive system of experimentally infected Rams (Ovis Aries). J Parasitol Res, doi:10.1155/2009/602803. Estrada-Peña, A., Farkas, R., Jaenson, T.G.T., Koenen, F., Madder, M., Pascucci, I., Salman, M., Tarrés-Call, J., Jongejan, F., 2013. Association of environmental traits with the geographic ranges of ticks (Acari: Ixodidae) of medical and veterinary importance in the western Palearctic. A digital data set. Exp. Appl. Acarol. 59, 351–366. https://doi.org/10.1007/s10493-012-9600-7 Gharbi, M., Darghouth, M.A., 2014. A review of Hyalomma scupense (Acari, Ixodidae) in the Maghreb region: from biology to control. Parasite 21. Hoogstraal, H., Traylor, M.A., Gaber, S., Malakatis, G., Guindy, E., Helmy, I., 1964. TICKS (IXODIDAE) ON MIGRATING BIRDS IN EGYPT, SPRING AND FALL 1962. Bull. World Health Organ. 30, 355–367. Keirans, J., Needham, G., 1999. The Ixodes ricinus complex worldwide: diagnosis of the species in the complex, hosts and distribution. Acarology. Noureddine, R., Chauvin, A., Plantard, O., 2011. Lack of genetic structure among Eurasian populations of the tick Ixodesricinus contrasts with marked divergence from north-African populations. Int. J. Parasitol. 41, 183–192. https://doi.org/10.1016/j.ijpara.2010.08.010 Tack, W., Madder, M., De Frenne, P., Vanhellemont, M., Gruwez, R., Verheyen, K., 2011. The effects of sampling method and vegetation type on the estimated abundance of Ixodes ricinus ticks in forests. Exp. Appl. Acarol. 54, 285–292. https://doi.org/10.1007/s10493-011-9444-6 Walker, A.R., Bouattour, A., Camicas, J.., Estrada-Pena, A., Horac, I.., Latif, A.A., Pegram, R.., Preston, P., 2003. Ticks of domestic animals in Africa: a guide to identification of species. Bioscience reports Edinburgh. Walker, A.R., Bouattour, A., Camicas, J.-L., Pena, A.E.-, Latif, A.A., Pegram, R., Preston, P., 2003. Ticks of Domestic Animals in Africa: A Guide to Identification of Species. Bioscience Reports.  8 Xu, G., Fang, Q.Q., Keirans, J.E., Durden, L.A., 2003. Molecular phylogenetic analyses indicate that the ixodes ricinus complex is a paraphyletic group. J. Parasitol. 89, 452–457. https://doi.org/10.1645/0022-3395(2003)089[0452:MPAITT]2.0.CO;2  

Population genetic analysis of Ixodes tick species and Toxoplasma gondii in Tunisia and their relationships to global populations

https://cgspace.cgiar.org/bitstream/10568/92899/3/sequencing_report.pdf

Population genetic analysis of Ixodes tick species and Toxoplasma gondii in Tunisia and their relationships to global populations

Abstract

Similar works

Full text

Available Versions

CGSpace