Background: Organophosphate pesticides (OP) are applied to agricultural farms and can be carried away into closely sewerage and gullies, which consequently carry water to rivers and lakes and when distributed in the environment they become polluted and require remediation.



Objectives: The current study aimed at producing a genetically engineered Pseudomonas plecoglossicida capable of biodegradation of the organophosphate pesticides, paraoxon.



Methods: Genetically engineered P. plecoglossicida was initially made by transferring polymerase chain reaction (PCR) product of opd gene from Flavobacterium sp. ATCC 27551 into the chromosome of P. plecoglossicida.



Results: The constructed strain could hydrolyze paraoxon to p-nitrophenol and di-ethylphosphate in paraoxon supplemented in complete supplement mixture (CSM) medium. The isolate could use paraoxon as the only source of carbon. Thus, the bacteria degraded the organophosphate pesticides, and utilized nutrient products of their degradation.



Conclusions: The observed versatility of genetically engineered P. plecoglossicida in biodegradation of xenobiotics suggested that this strain may be useful for the multipurpose bioremediation of contaminated agricultural and industrial sites.



Keywords: Organophosphates; Pesticide; Bioremediation; Pseudomonas plecoglossicid

Alizadeh, Safar Ali

Aslanimehr, Masoumeh

Johari, Pouran

Najafipour, Reza

Naserpour Farivar, Taghi

Peymani, Dr. Amir

Qazvin University of Medical Sciences Repository

Biotech Health Sci. 2017 February; 4(1):e45055.Published online 2017 February 12.doi: 10.17795/bhs-45055.Research ArticleBiodegradation of Paraoxan as an Organophosphate Pesticide withPseudomonas plecoglocissida Transfected by opd GeneTaghi Naserpour Farivar,1,* Amir Peymani,2 Reza Najafipour,1 Masoumeh Aslani Mehr,1 Safar AliAlizadeh,1 and Pouran Johari11Cellular and Molecular Research Center, Qazvin University of Medical Sciences, Qazvin, IR Iran2Medical Microbiology Research Center*Corresponding author: Taghi Naserpour Farivar, Cellular and Molecular Research Center, Qazvin University of Medical Sciences, Shahid Bahonar Blv., Qazvin, IR Iran. Tel:+98-2833324971, Fax: +98-2833324971, E-mail: t.naserpour@qums.ac.irReceived 2016 December 29; Revised 2017 January 17; Accepted 2017 January 17.AbstractBackground: Organophosphate pesticides (OP) are applied to agricultural farms and can be carried away into closely sewerageand gullies, which consequently carry water to rivers and lakes and when distributed in the environment they become pollutedand require remediation.Objectives: The current study aimed at producing a genetically engineered Pseudomonas plecoglossicida capable of biodegradationof the organophosphate pesticides, paraoxon.Methods: Genetically engineered P. plecoglossicida was initially made by transferring polymerase chain reaction (PCR) product ofopd gene from Flavobacterium sp. ATCC 27551 into the chromosome of P. plecoglossicida.Results: The constructed strain could hydrolyze paraoxon to p-nitrophenol and di-ethylphosphate in paraoxon supplemented incomplete supplement mixture (CSM) medium. The isolate could use paraoxon as the only source of carbon. Thus, the bacteriadegraded the organophosphate pesticides, and utilized nutrient products of their degradation.Conclusions: The observed versatility of genetically engineered P. plecoglossicida in biodegradation of xenobiotics suggested thatthis strain may be useful for the multipurpose bioremediation of contaminated agricultural and industrial sites.Keywords: Organophosphates, Pesticide, Bioremediation, Pseudomonas plecoglossicida1. BackgroundTremendous development of chemical industry in thepast century made possible the present quality of life, butas a side effect, enormous amounts of synthetic chemi-cals are discharged into the environment either intention-ally (as waste deposits, fertilizers, or pesticides) or acci-dentally. Therefore, today a remarkable number of earth-bound and marine habitats are contaminated by variouschemical compounds which many of them are harmful forliving organisms.Due to their impact and threat for human health,organophosphorus compounds are of great concern.Organophosphate pesticides are a heterogeneous groupwith a phosphoric acid derivative chemical structure.These synthetic chemicals have a cholinesterase-inhibitingactivity and at the present time, organophosphate pes-ticides are widely used in the developing countries (1).Occupational exposure in agricultural industries andself-poisoning with organophosphate pesticides pro-duce remarkable health problems (2-7). Exposure toorganophosphate pesticides results in millions of poison-ing (8-11). Organophosphate pesticides are utilized directlyto the soil and can be washed off into the nearby sewerageand gullies, and consequently carry water to rivers andlakes and when these substances distributed in the envi-ronment they become polluted and require remediation(12-14). Degradation of organophosphate compoundsby microbial enzymes is the focus of biodegradationresearches. Organophosphate-degrading bacteria havethe same organophosphate hydrolyzing enzymes. OPhydrolase is a zinc-containing protein found to hydrolyzeparaoxon (15). The enzyme is encoded by an organophos-phate degradation gene (opd) and can hydrolyze a varietyof oxon and thion organophosphates (16, 17). The opd isreported in different taxonomic groups of soil microor-ganisms, which suggested its spread by transposons,plasmids, and phages as transfer vehicles (18, 19).Previous studies suggested Pseudomonas species ascompetent microorganisms for microbial remediationand degradation (14, 20, 21) and within this genus, Pseu-domonas plecoglossicida, which is a soil habitant, attractedmuch attentions (22).Copyright © 2017, Qazvin University of Medical Sciences. This is an open-access article distributed under the terms of the Creative Commons Attribution-NonCommercial4.0 International License (http://creativecommons.org/licenses/by-nc/4.0/) which permits copy and redistribute the material just in noncommercial usages, provided theoriginal work is properly cited.Naserpour Farivar T et al.2. ObjectivesThe current experimental study aimed at construct-ing new genetically engineered P. plecoglossicida capableof degradation of paraoxon as an organophosphorus pes-ticide.3. MethodsChemicals, enzymes, and oligonucleotides: Allchemical reagents including paraoxon (O,O-diethylO-p-nitrophenyl phosphate) were obtained from Sigma-Aldrich (Tehran, Iran). Proteinase K purchased from Roche(Tehran, Iran), and synthetic dNTPs from Takapou Zist(Tehran, Iran).Bacterial growth: Carbon-deficient medium (CSM) hadthe following composition: 0.2 g/L MgSO4.7H2O; 0.08 g/LCa(NO3)2.4H2O; 0.005 g/L FeSO4.7H2O; 4.8 g/L KH2PO4; 1.2g/L KH2PO4. CSM was supplemented with an appropri-ate carbon source just before inoculation. Luria-Bertanimedium (LB) with the following composition was used: 1.5g/L Bacto agar; 10 5 g/L yeast extract; g/L Bacto tryptone;10 g/L NaCl; all purchased from Difco Laboratories, Detroit,MI, USA. The pH of both mediums was 7.5.Evaluation of biodegradation effect of modified P.plecoglossicida on paraoxon: To assess the biodegradationeffect of modified P. plecoglossicida on paraoxon, the bacte-rial suspension was spread on CSM agar plates containingincreasing concentrations of organophosphate. Paraoxonconcentrations in agar were 100, 200, 300, and 400µg /mL.The plates were incubated at 37°C for 20 hours (23).Degradation of organophosphate by resting cells:Degradation experiment of OP was performed as previ-ously described by Lyer et al. (23). Briefly, 150 mL of LBmedium was inoculated with transfected P. plecoglossicidaon a rotary shaker at 37°C with 200 rpm rotation untilcell density reached 1.0 at OD = 600. Cells were harvested,washed, and re-suspended in the same potassium phos-phate buffer. The degradation experiment was done bymixing the cell suspension with 100 µg/mL of paraoxonand incubation at 30°C and 120 rpm of shaking. At regularintervals aliquots were taken, centrifuged, and analyzed toremove the test compound and accumulation of its degra-dation products. Decomposition of organophosphate pes-ticides was monitored by high performance liquid chro-matography under the previously described conditions(24). Briefly, the study used 25× 14 mm C18 Hichrom col-umn with 80% acetonitrile, 19.5% distilled deionized wa-ter (DDW) and 0.5% acetic acid solution as mobile phase;flow rate was 1.5 mL/minute and detection was done at ab-sorbance 246 nm. All tests were repeated 3 times. All statis-tical tests were conducted by SPSS ver.14 software.3.1. Isolation of Cellular DNACetyl trimethylammonium bromide (CTAB) methodwas employed for total cellular DNA extraction as de-scribed before. Briefly, cells were resuspended in TE buffer,containing 50,000 Units/mL lysozyme and 300 K Units/mLribonuclease A, and maintained for 1 hour at 37°C. Prior tolysis, 0.25 mg/mL of proteinase K was added and cells werelysed by application of 0.5% (w/v) sodium dodecyl sulfate(SDS) at 37°C for 1 hour and DNA was precipitated by stan-dard phenol chloroform procedure.3.2. Amplification and Insertion of Organophosphorus Hydro-lase Gene Into P. plecoglossicidaAmplification of OP hydrolase gene was evaluatedby polymerase chain reaction (PCR) with the followingprimers from parathion hydrolase gene of Flavobacteriumsp. ATCC 27551; forward primer: CGCCACTTTCGATGCGAT;reverse primer: CTTCTAGACCAATCGCACTG (23). PCR pro-gram was as follows: 4.5 minutes at 94°C, 32 cycles at 94°Cfor 30 seconds, 55°C for 30seconds and 72°C for1 minutewith a final elongation step at 72°C for 4 minutes. PCR prod-ucts were analyzed by electrophoresis in a 0.8% agarose gelin Tris/borate/EDTA (TBE) buffer. Separated DNA fragmentswere excised from the gel, purified as described, and then,1700-bp opd genes (25) were inserted into the pUC57 plas-mid according to the instruction of the Template Genera-tion System II kit (Thermo Scientific, Nedaye Fan, Tehran,Iran), and transfected to P. plecoglossicida. Briefly, 4 µL ofamplified opd gene DNA; 10 µL of H2O; 4 µL of 5X reac-tion buffer; 1 µL of MuA transposase, and 1 µL of Entrance-poson™ (CamR-3) were mixed and incubated for 1 hour at30°C; then, incubated at 75°C for 10 minutes and after that,the amplified plasmid was transformed into Stella compe-tent cells. Presence of the plasmid in P. plecoglossicida wasconfirmed by amplification by the following PCR mixture:14.4 µL of H2O; 4 µL of 5X Phire reaction buffer; 0.4 µL of200 µM each dNTPs (10 mM each); 0.4 µL of each pUC for-ward and reverse primers (25µM) 0.5µM; 0.4µl of Mu endprimer (25µM) 0.5µM; 0.4µL of Phire Hot Start II DNA Poly-merase, and 20µL of the following primer sequences:Mu end primer: 5’-GTTTTTCGTGCGCCGCTTCA-3’; pUCreverse primer: 5’-TTATGCTTCCGGCTCGTATGTTGTGT-3’ orpUC forward primer: 5’-AGCTGGCGAAAGGGGGATGTG-3’ ac-cording to the following program: 98°C for 30 seconds, 30cycle of 98°C for 5 seconds, and 72°C for 1 minute. A 1750-bpPCR final product indicated the presence of plasmid.4. Results and DiscussionThe bacterial strain designated as modified P. plecoglos-sicida was created by inserting PCR product of the ampli-fication of opd gene of Flavobacterium sp. ATCC 27551 into2 Biotech Health Sci. 2017; 4(1):e45055.Naserpour Farivar T et al.the pUC57 plasmid, and transfection of P. plecoglossicidawith this plasmid. Pure culturing of transfected strain inparaoxon supplemented CSM medium changes the colorin the culture medium to yellow, which confirmed itsability to hydrolyze paraoxon to p-nitrophenol and di-ethylphosphate. The isolated bacteria grew on carbon-deficient agar containing 100 to 400 µg/mL paraoxon asavailable carbon sources (Figure 1). This result suggestedthat the strain could degrade the organophosphate pesti-cides and use the products of this biodegradation.Figure 1. Growth of Modified Pseudomonas plecoglossicida on CSM Agar Supple-mented with 100 - 400µg/mL Paraoxon as the Only Available Carbon SourcesDegradation of paraoxon by modifiedP.plecoglossicida was started with a 100 µg/mL ofparaoxon. Concentration of p-nitrophenol, as a byproductof degradation of paraoxon in the media was evaluatedby absorbance at 405 nm. The effect of spontaneousOP hydrolysis was corrected by subtracting the amountof p-nitrophenol formed in the presence of Escherichiacoli ATTC 25922/pUC57 cells as non-organophosphatepesticides degrading control (data not shown).Detection of the gene in the transfected P. plecoglos-sicida was performed by analytical PCR with opd specificprimers (23). PCR, on the whole, modified P. plecoglossicidagenomic DNA, which resulted in a single amplicon for eachof the F450 - R840 primers (Figure 2).Chromatograms of paraoxon after 24 hours of inocu-lation in CSM broth containing 400 µg/mL of paraoxonshowed that the concentrations of paraoxon decreased af-ter incubation with P. plecoglossicida suspension. Thesechromatograms showed a reverse relationship between in-cubation time and concentration of paraoxon in the cul-ture tubes (Figure 3).Organophosphate pesticides are directly applied to theagricultural farms and can be washed off into the nearbysewerage and gullies, which are consequently carried bywater to rivers and lakes and when spread in the environ-ment they become polluted and require remediation (12-14).The ability of transfected P. plecoglossicida to prolif-erate in the environment containing toxic substances byusing these substances as nutrients suggests tight con-trol over their uptake and intracellular concentration.The discovered biodegradation capabilities of transfectedFigure 2. Detection of opd Gene in the Transfected Pseudomonas plecoglossicida byAnalytical PCR Using opd Specific PrimersP. plecoglossicida may find application in a variety oftasks. The strain can be used to accelerate internaliza-tion of organophosphate pesticides in agricultural sys-tems, sewage water, and leaks of petroleum hydrocarbonsand related industrial chemicals.AcknowledgmentsAuthors would like to thank deputy of Research andTechnology of Qazvin University of Medical Sciences,Qazvin, Iran, for financial support, and Dr. Faramarzi,school of pharmacology, Tehran University of Medical Sci-ences, Tehran, Iran, for providing Pseudomonas plecoglossi-cida standard isolates.FootnotesAuthors’ Contribution: Taghi Naserpour Farivar: design-ing the study, performing the experiment and data analy-sis; Masoumeh Aslani Mehr and Reza Najafipour: data anal-ysis; Pouran Johari: performing the experiments and dataBiotech Health Sci. 2017; 4(1):e45055. 3Naserpour Farivar T et al.00.00             02.00                 04.00                06.00                08.00               10.00 00.00                                     02.00                                       04.00                                     06.00    Time, mmssAbsorbance, mA31623314966-17A BFigure 3. A, Paraoxon (400 µg/mL) in Carbon-Deficient Minimal Medium; B, After 24 Hours Of Incubation with 0.5 mL of Modified Pseudomonas plecoglossicida Suspension(0.5 McFarland); 25× 14 mm C18 Hichrom Column Was Used with 80% Acetonitrile, 19.5% DDW, and 0.5% Acetic Acid Solution as Mobile Phase; Flow Rate was 1.5 mL/min andDetection Was Done at the Wave Length of 246 nm. All tests were repeated 3 times.analysis; Amir Peymani and Safar Ali Alizadeh: designingthe study, performing the experiment and data analysisFinancial Disclosure: There was not conflict of interest.Funding/Support: The study was financially supported byQazvin University of Medical Sciences, Qazvin, Iran.References1. Eddleston M, Karalliedde L, Buckley N, Fernando R, HutchinsonG, Isbister G, et al. Pesticide poisoning in the developing world–aminimum pesticides list. Lancet. 2002;360(9340):1163–7. [PubMed:12387969].2. Karalliedde L, Senanayake N. Organophosphorus Insecticide Poison-ing. Br J Anaesth. 1989;63(6):736–50. doi: 10.1093/bja/63.6.736.3. van der Hoek W, Konradsen F. Analysis of 8000 hospital admissionsfor acute poisoning in a rural area of Sri Lanka. Clin Toxicol (Phila).2006;44(3):225–31. [PubMed: 16749538].4. Van der Hoek W, Konradsen F, Athukorala K, Wanigadewa T. Pesti-cide poisoning: a major health problem in Sri Lanka. Soc Sci Med.1998;46(4-5):495–504. [PubMed: 9460829].5. Eddleston M, Eyer P, Worek F, Mohamed F, Senarathna L, vonMeyer L, et al. Differences between organophosphorus insec-ticides in human self-poisoning: a prospective cohort study.Lancet. 2005;366(9495):1452–9. doi: 10.1016/S0140-6736(05)67598-8.[PubMed: 16243090].6. Jeyaratnam J, Lun KC, Phoon WO. Survey of acute pesticide poisoningamong agricultural workers in four Asian countries. Bull World HealthOrgan. 1987;65(4):521–7. [PubMed: 3500805].7. Calvert GM, Karnik J, Mehler L, Beckman J, Morrissey B, Sievert J,et al. Acute pesticide poisoning among agricultural workers in theUnited States, 1998-2005. Am J Ind Med. 2008;51(12):883–98. doi:10.1002/ajim.20623. [PubMed: 18666136].8. Buckley NA, Karalliedde L, Dawson A, Senanayake N, Eddleston M.Where is the evidence for treatments used in pesticide poisoning? Isclinical toxicology fiddling while the developing world burns?. J Tox-icol Clin Toxicol. 2004;42(1):113–6. [PubMed: 15083947].9. Jeyaratnam J. Acute pesticide poisoning: a major global health prob-lem. World Health Stat Q. 1990;43(3):139–44. [PubMed: 2238694].10. World Health Organization . The public health im-pact of pesti-cides use in agriculture Geneva: WHO; 2012. Available from: http://whqlibdoc.who.int/publications/1990/9241561394.pdf .11. Kesavachandran CN, Fareed M, Pathak MK, Bihari V, Mathur N, Srivas-tava AK. Adverse health effects of pesticides in agrarian populationsof developing countries. In: Whitacre DM, editor. Reviews of Environ-mental Contamination and Toxicology. New York: Springer ScienceBusiness Media; 2009. pp. 33–52.12. Abo-Amer A. Biodegradation of diazinon by Serratia marcescens DI101and its use in bioremediation of contaminated environment. J Micro-biol Biotechnol. 2011;21(1):71–80. [PubMed: 21301195].13. Arbeli Z, Fuentes CL. Accelerated biodegradation of pesticides: Anoverview of the phenomenon, its basis and possible solutions; and adiscussion on the tropical dimension. Crop Protect. 2007;26(12):1733–46. doi: 10.1016/j.cropro.2007.03.009.14. Geetha M, Fulekar M. Bioremediation of pesticides in surface soiltreatment unit using microbial consortia. African Journal of Environ-mental Science and Technology. 2008;2(2):036–45.15. Caldwell SR, Newcomb JR, Schlecht KA, Raushel FM. Limits of diffu-sion in the hydrolysis of substrates by the phosphotriesterase fromPseudomonas diminuta. Biochemistry. 1991;30(30):7438–44. [PubMed:1649628].16. Dumas DP, Caldwell SR, Wild JR, Raushel FM. Purification and prop-erties of the phosphotriesterase from Pseudomonas diminuta. J BiolChem. 1989;264(33):19659–65. [PubMed: 2555328].17. Dumas DP, Wild JR, Raushel FM. Diisoproplyfluorophosphate hydrol-ysis by a phosphotriesterase from Pseudomonas diminuta. Bio Tech-nol Appl Biochem. 1989;11:235–43.18. Siddavattam D, Khajamohiddin S, Manavathi B, Pakala SB, MerrickM. Transposon-like organization of the plasmid-borne organophos-phate degradation (opd) gene cluster found in Flavobacterium sp.Appl Environ Microbiol. 2003;69(5):2533–9. [PubMed: 12732518].19. Somara S, Manavathi B, Tebbe CC, Siddavatam D. Localisation of iden-tical organophosphorus pesticide degrading (opd) genes on genet-ically dissimilar indigenous plasmids of soil bacteria: PCR amplifi-cation, cloning and sequencing of opd gene from Flavobacteriumbalustinum. Indian J Exp Biol. 2002;40(7):774–9. [PubMed: 12602326].20. Park SC, Shimamura I, Fukunaga M, Mori KI, Nakai T. Isolation ofbacteriophages specific to a fish pathogen, Pseudomonas plecoglos-sicida, as a candidate for disease control. Appl Environ Microbiol.2000;66(4):1416–22. [PubMed: 10742221].21. Fulekar MH, Geetha M. Bioremediation of Chlorpyrifos by Pseu-domonas aeruginosa using scale up technique. J Appl Biosci.2008;12:657–60.22. Cetın AK, Gur N, Fırat Z. Growth rate of Scenedesmus acutus in labora-tory cultures exposed to diazinon. Afr J Biotechnol. 2011;10(34):6540–3.4 Biotech Health Sci. 2017; 4(1):e45055.Naserpour Farivar T et al.23. Iyer R, Stepanov VG, Iken B. Isolation and molecular characteriza-tion of a novel <i>pseudomonas putida</i> strain capable of de-grading organophosphate and aromatic compounds. Adv Biol Chem.2013;03(06):564–78. doi: 10.4236/abc.2013.36065.24. Borji A, Naserpour Farivar G, Johari P, Naserpour Farivar T, Senemari S,Karimi G. Cleaning From the Inside: Biodegradation of Organophos-phate Pesticides by Pseudomonas plecoglossicida. Biotechnol HealthSci. 2014;1(1) doi: 10.17795/bhs-19193.25. Mulbry WW, Karns JS. Parathion hydrolase specified by the Flavobac-terium opd gene: relationship between the gene and protein. J Bacte-riol. 1989;171(12):6740–6. [PubMed: 2556372].Biotech Health Sci. 2017; 4(1):e45055. 5

Biodegradation of Paraoxan as an Organophosphate Pesticide with Pseudomonas plecoglocissida Transfected by opd Gene

http://eprints.qums.ac.ir/7460/1/bhs-04-01-45055.pdf

Biodegradation of Paraoxan as an Organophosphate Pesticide with Pseudomonas plecoglocissida Transfected by opd Gene

Abstract

Similar works

Full text

Available Versions

Qazvin University of Medical Sciences Repository