Ciarcia, R.

Fiorito, F.

Florio, S.

Montagnaro, S.

Pagnini, C.

Pellicane, A.

Russo, R.

R. Ciarcia

C. Pagnini

F. Fiorito

A. Pellicane

S. Montagnaro

R. Russo

S. Florio

Archivio della ricerca - Università degli studi di Napoli Federico II

ABSTRACTEffect of “All - trans” retinoic acid in canine osteosarcomachemotherapyR. Ciarcia & C. Pagnini & F. Fiorito & A. Pellicane &S. Montagnaro & R. Russo & S. FlorioPublished online: 19 August 2008# Springer Science + Business Media B.V. 2008Keywords Antineoplastic drugs . Canine osteosarcoma . Retinoic acid . TelomeraseAbbreviationsATRA “all-trans” retinoic acidCIS CisPlatinDOXO DoxorubicinEPI EpirubicinIntroductionOsteosarcoma is the most common bone tumour in humans (Goorin et al., 1985) and, inveterinary medicine, especially in dogs (Harley et al., 1994). This tumor originates fromundifferentiated mesenchymal cells during normal osteogenic processes. The role of ATRAin the cell differentiation of normal epithelial tissues has been well demonstrated (Lippmanet al., 1987). Currently retinoids are also used in clinical practice as differentiative agents inhuman leukaemias (Moore, 1967). However, information on the effects of retinoids on solidtumors is limited. Telomerase, a ribonucleoproteic enzyme acting in the terminal site of theVet Res Commun (2008) 32 (Suppl 1):S267–S269DOI 10.1007/s11259-008-9125-zR. Ciarcia : S. FlorioDipartimento di Strutture, Funzioni e Tecnologie Biologiche, Università di Napoli “Federico II”,Napoli, ItalyC. Pagnini : F. Fiorito : S. Montagnaro : R. RussoDipartimento di Patologia e Sanità animale, Università di Napoli “Federico II”, Napoli, ItalyA. PellicaneDVM, Veterinary practitioner, Trapani, ItalyR. Ciarcia (*)Dipartimento di Strutture, Funzioni e Tecnologie Biologiche, Università di Napoli “Federico II”,via Delpino 1, 80137 Napoli, Italye-mail: roberto.ciarcia@unina.itchromosome (TTAGGG)n, plays a key role in the process of “cellular immortalization” andis thus an important target for chemotherapy (Blackburn et al., 1991). Anthracyclines andplatinum derivatives are wide spectrum chemotherapics, largely used in therapy for solidtumours but with severe adverse effects (Pacilio et al., 1998). In this study we evaluated thechemosensitizing activity of ATRA on D17 canine osteosarcoma, in relation tochemotherapeutic schemes based on anthracyclines and cisplatin. Specifically, we studiedthe activity of these chemotherapeutic agents, used alone or in association with ATRA, ontelomerase activity, apoptosis and D17 cell viability.Materials and methodsWe used D17 canine osteosarcoma cell lines that were maintained in RPMI-1640 medium,supplemented with 10% fetal bovine serum (FBS), L-glutamine and antibiotics (62.5 mg/mlpenicillin and 100 mg/ml streptomycin) and incubated at 37°C in a humidified atmosphere of5% CO2. Cytotoxicity assay: Drug Cytotoxicity was assayed by means of the MTT (3–4,5-dimethylthiazol-2-yl-2,5.diphenyl tetrazolium bromide; Sigma) assay. Apoptosis: In orderto detect oligonucleosomal DNA fragmentation, the Cell Death Detection ELISA Plus(Roche Diagnostics, Milan, Italy) was used. Telomerase activity was evaluated by TelomericRepeat Amplification Protocol (TRAP) assay using the TeloTAGG Telomerase PCRELISAPLUS (Roche Diagnostics, Milan, Italy): This is a semiquantitative protocol thatemploys telomere-mimetic oligonucleotide TS (5′ AATCCGTCGAGCAGAGTT) anddownstream amplification oligo CX (5′ CCCTTACCTTACCCTTACCCTAA) plays a keyrole in the process of “cellular immortalization". Statistical Analysis: The results are presentedas mean ± SD of three independent experiments. One-way ANOVAwith Turkey’s post testwas performed using GraphPad InStat Version 3.00 for Windows 95 (GraphPad Software,San Diego, California). An error probability with P<0.05 was selected as significant.ResultsThe cytotoxic activity of chemotherapic drugs on D17 canine osteosarcoma cells wasevaluated by means of a concentration effect curve. After 48 hours of incubation atconcentrations between 0.1 and 100 µM of DOXO, EPI, CIS and ATRA, D17 cells werefound to be relatively insensitive to CIS and ATRA, while DOXO and EPI at a concentrationof 50 µM decreased cell viability by 43.5% (DOXO) and 49.2% (EPI). Addition of ATRA atan equimolecular concentration was able to decrease anthracycline and cisplatin induced cellviability. In fact the cell viability, respectively, shifted by a reduction of 43.5% (DOXO) to61.1% (DOXO+ATRA) and from 49.2% (EPI) to 62.3% (EPI+ATRA) and from 10.1% (CIS)to 43.7% (CIS+ATRA). Chemotherapeutic drugs used alone showed no effect on telomeraseactivity while ATRA at a 0.5 µM concentration was significantly able to decrease this activity:in fact the absorbance shifted from 1.1 to 0.31. Addition of ATRA, at an equimolecularconcentration, to chemotherapeutic drug-treated tumour cells decreased telomerase activity,the absorbance shifted from 1.09 (DOXO) to 0.79 (DOXO+ATRA), from 1.16 (EPI) to 0.74(EPI+ATRA) and from 0.82 (CIS) to 0.66 (CIS+ATRA). Both chemotherapeutic drugs eitherused alone or in association with ATRA induced apoptosis. In fact, the percentage ofapoptotic cells shifted from 12.2% (DOXO) to 32.1% (DOXO+ATRA); from 11.5% (EPI) to24.4% (EPI+ATRA) and from 11.8% (CIS) to 34.8% (CIS+ATRA).S268 Vet Res Commun (2008) 32 (Suppl 1):S267–S269DiscussionIs known that Apoptosis is defined by a cascade of biochemical events leading to nuclearfragmentation and cell death. The cytotoxic effect of most chemotherapeutic agents in vitroand in vivo depends on the induction of apoptosis in susceptible tumour cells (Schmitt andLowe, 1999). Our data demonstrated that Doxorubicin, Epirubicin and Cisplatin induceapoptosis in D17 canine osteosarcoma cells and that ATRA is probably able tochemosensitise tumor cells to drug-induced apoptosis. Results reported in the presentstudy demonstrate down-regulation of telomerase activity in D17 treated with anthraci-clyne, cisplatin and ATRA. Combination drug therapy has emerged as a leading-edgeconcept for the treatment of cancer and the results reported herein suggest that ATRA couldhave an important role in this strategy.Acknowledgements This work was supported by grants from Italian Ministry of University and Research.ReferencesBlackburn E.H., 1991. Structure and function of telomeres. Nature, 350, 569–573.Goorin A.M., Abelson H.T., Frei E. 3rd., 1985. Osteosarcoma: fifteen years later. The New England journalof medicine, 313, 1637–1643.Harley C.B., Kim N.W., Prowse K.R., Weinrich S.L., Hirsch K.S., West M.D., Bacchetti, S., Hirte H.W.,Counter C.M., Greider C.W., 1994. Telomerase, cell immortality, and cancer. Cold Spring Harborsymposia on quantitative biology, 59, 307–315.Lippman S.M., Kessler J.F., Meyskens F.L. Jr., 1987. Retinoids as preventive and therapeutic anticanceragents (Part I). Cancer treatment reports, 71, 319–405.Moore, T., 1967. Effect of vitamin A deficiency in animals: pharmacology and toxicology of vitamin A. In:The Vitamins, W.H. Sebrill and R.S. Harris (Eds.). Academic Press: New York, 1, 245–266.Pacilio C., Florio S., Pagnini U., Crispino A., Claudio P.P., Pacilio G., Pagnini G., 1998. Modification ofmembrane fluidity and depolarization by some anthracyclines in different cell lines. Anticancer research,18, 4027–4034.Schmitt C.A. and Lowe S.W., 1999. Apoptosis and therapy. The Journal of pathology, 187, 127–131.Vet Res Commun (2008) 32 (Suppl 1):S267–S269 S269

Effect of "All - trans" retinoic acid in canine osteosarcoma chemotherapy.

https://www.iris.unina.it/retrieve/handle/11588/702826/166073/19%29Effect%20of%20%e2%80%9cAll%20-%20trans%e2%80%9d%20retinoic%20acid%20in%20canine%20osteosarcoma.pdf

Effect of "All - trans" retinoic acid in canine osteosarcoma chemotherapy.

Abstract

Similar works

Full text

Available Versions

Archivio della ricerca - Università degli studi di Napoli Federico II