<p>a) Promoters and genomic regions of <i>hmgcr</i> gene. Two mRNAs are transcribed (mRNA<sub>A</sub> and mRNA<sub>B</sub>) under the control of two distinct promoter regions. After splicing, the encoding regions of the two cDNA are identical. A computer analysis of the genomic DNA region has allowed to find two E-Box consensus sequences (CATGTG) <a href="http://www.plosone.org/article/info:doi/10.1371/journal.pone.0000187#pone.0000187-Wang1" target="_blank">[63]</a> localized at −3194 to −3188 and −1315 to −1309, and one E-Box High affinity (GATGACCCGGTCGAGGAG) <a href="http://www.plosone.org/article/info:doi/10.1371/journal.pone.0000187#pone.0000187-Vallett1" target="_blank">[64]</a> localized at −2051 to −2033, comprised in a region of 3,8 kb just upstream of the first exon of <i>hmgcr</i>. We then hypothesized that this region could control the RNA<sub>A</sub> transcription, and cloned and used it to generate the p[DI-3-GAL4] (DI-3) line. To generate the p[DI-11-GAL4] (DI-11) line, we cloned a fragment of 10,6 kb of the first intron (+2733 to +13525) in which we found an E-box consensus <a href="http://www.plosone.org/article/info:doi/10.1371/journal.pone.0000187#pone.0000187-Wang1" target="_blank">[63]</a> (+2911 to +2916) and one SRE1 (AATTAGTCTGTACCCCAATT) <a href="http://www.plosone.org/article/info:doi/10.1371/journal.pone.0000187#pone.0000187-Vallett1" target="_blank">[64]</a> (+3551 to +3570). We hypothesized that this region could control the RNA<sub>B</sub> transcription. b) Schematic lateral view of the head and thorax of <i>Drosophila</i>. card: <i>cardia</i>; <i>ca</i>: <i>corpus allatum</i>; br: brain. c–h) The two p[DI-GAL4] lines (DI-3 and DI-11) drive the expression of GFP in the <i>ca</i>. c) At low magnification (10X), the <i>ca</i>, in green, is detected by using primary antibodies against GFP and secondary antibodies labeled with FITC (green) in flies DI-3/GFP. The background is artificially colored in blue. d) The <i>corpus cardiacum</i> (<i>cc</i>) is a structure located near the <i>ca</i>. To confirm that the GFP is expressed in the <i>ca</i>, the <i>corpus cardiacum</i> (<i>cc</i>) was stained using an anti-AKH antibody <a href="http://www.plosone.org/article/info:doi/10.1371/journal.pone.0000187#pone.0000187-Isabel1" target="_blank">[56]</a> directly conjugated to the rhodamine (red). Thus, we can visualize the <i>ca</i> in green and the <i>cc</i> in red. e) The GFP (left, green) and HMGCR (middle, red) are detected with primary and secondary antibody. Those last are labeled respectively with FITC (green) or Cy3 (red). When merged, we can see that the GFP and HMGCR are colocalized (right panel: yellow), confirming that the DI-3 drives the GFP in the same cells of the <i>ca</i> that express the HMGCR. f) Dissection of the <i>cardia</i> and the <i>ca</i> from DI-3/UAS-<i>gfp</i> flies of different ages and observed directly under a binocular lamp fit with a green fluorescent filter (Leica, MZ FLIII). The GFP is driven by DI-3 in the <i>ca</i> in a temporal dynamic pattern. In two days old adult flies (left panel), the GFP is well detectable in the <i>ca</i> (arrowhead), but not anymore in 5 days old flies (right panel). However, in 5 days old flies, the GFP is detectable in a thin layer of the <i>cardia</i>. g) Dissection of <i>cardia</i> and <i>ca</i> from (DI-11/UAS-<i>gfp</i>) directly observed under a binocular lamp fit with a green fluorescent filter (Leica, MZ FLIII). DI-11 also drives the expression of GFP in the <i>ca</i> (arrowhead), and this expression is permanent in adult flies. h) GFP (left) and HMGCR (middle) are detected respectively with primary antibodies against GFP and HMGCR and revealed with secondary antibodies respectively labeled with FITC (green) and Cy3 (red). When merged, we can see that the GFP and HMGCR are colocalized (right panel: yellow), confirming that the DI-11 drives the GFP in the same cells of the <i>ca</i> that express the HMGCR. Scale bar = 25 µm.</p
