Coagulase negative Staphylococcus (CoNS) are common colonizers of the human skin but has become increasingly

recognized as agents of clinically significant infections. At the Universiti Kebangsaan Malaysia Medical Centre

(UKMMC), the prevalence of CoNS among staphylococcus genus in 2009 was 47.1%. The aim of this study was to

identify Staphylococcus epidermidis, S. saprophyticus and S. xylosus from the CoNS and MRCoNS (methicillin resistant

CoNS) collected in 2009 using a multiplex PCR approach with primers specific for each species. Our results showed

that S. epidermidis is the most common species among both MRCoNS and CoNS isolates in UKMMC. Among 1142 CoNS

strains, 68.4% were S. epidermidis, 1.3% were S. saprophyticus while 30.3% were non-typeable (other species). A total of 659 CoNS strains have been identified as methicillin resistant (MRCoNS); where 68.1% were S. epidermidis,1.5% was S. saprophyticus and 30.3% were from other CoNS species. S. xylosus was not identified among the isolates

Ainihayati Noordin,

Hassriana Fazilla Sapri,

Neoh, Hui-min

Nurul Azirah Mohamad Sani,

Salasawati Hussin,

English

UKM Journal Article Repository

Asia-Pacific Journal of Molecular Medicine 2011, 1:5Species Identification of Coagulase Negative Staphylococci (CoNS) Isolates inUniversiti Kebangsaan Malaysia Medical Centre (UKMMC)1Nurul Azirah Mohamad Sani, 1Hassriana Fazilla Sapri, 1Ainihayati Noordin, 2Hui-min Neoh* and 1Salasawati Hussin*1Department of Medical Microbiology and Immunology, Faculty of Medicine, Universiti Kebangsaan Malaysia;2UKM Medical Molecular Biology Institute (UMBI), Universiti Kebangsaan MalaysiaReceived on 15/12/2010 / Accepted on 23/05/2011ABSTRACTCoagulase negative Staphylococcus (CoNS) are common colonizers of the human skin but has become increasinglyrecognized as agents of clinically significant infections. At the Universiti Kebangsaan Malaysia Medical Centre(UKMMC), the prevalence of CoNS among staphylococcus genus in 2009 was 47.1%. The aim of this study was toidentify Staphylococcus epidermidis, S. saprophyticus and S. xylosus from the CoNS and MRCoNS (methicillin resistantCoNS) collected in 2009 using a multiplex PCR approach with primers specific for each species. Our results showedthat S. epidermidis is the most common species among both MRCoNS and CoNS isolates in UKMMC. Among 1142 CoNSstrains, 68.4% were S. epidermidis, 1.3% were S. saprophyticus while 30.3% were non-typeable (other species). Atotal of 659 CoNS strains have been identified as methicillin resistant (MRCoNS); where 68.1% were S. epidermidis,1.5% was S. saprophyticus and 30.3% were from other CoNS species. S. xylosus was not identified among the isolates.INTRODUCTIONCoagulase negative Staphylococci (CoNS) are commoncolonizers of the human skin and was once consideredrelatively avirulent and probably a contaminant whenisolated from clinical specimens. However, these organismshave become increasingly recognized as agents of clinicallysignificant infections [1], especially in immunocompromisedpatients who have prostheses and other invasive medicaldevices in place [2]. Therefore, patients warded in burnunits as well as neonatal and pediatric intensive care unitshave a high risk for CoNS infections [3].Besides their pathogenicity, CoNS are also inherentlyresistant to antimicrobial agents like methicillin [4].Methicillin resistant CoNS (MRCoNS) are clinicallyimportant as they are resistant to all β-lactam agents andother commonly used antimicrobial agents. Subsequently,an outbreak of MRCoNS has the potential of causingwidespread antimicrobial resistance in a hospital setting,causing additional problems to patient management in termsof antimicrobial prescription. CoNS like S. epidermidis ismore likely to be multidrug resistant compared to otherCoNS species [5], therefore it has become increasinglyimportant to rapidly identify these organisms for betterpatient management.Two species of CoNS commonly associated withhuman infection are S. epidermidis and S. saprophyticus.S. epidermidis is well documented as a pathogen in casesof bacteraemia, prosthetic valve endocarditis, andprosthetic joint infections. S. saprophyticus is recognizedas an opportunistic pathogen in urinary tract infections,particularly in young sexually active females. S. xylosushas very occasionally been identified as a cause of humaninfection and has been associated with pyelonephritis inhumans.As a pilot study into staphylococcal strains isolatedin our university’s medical centre, we collected index strainsof Staphylococcus sp. isolated in 2009, and determined theprevalence of CoNS among Staphylococcus genus in ourhospital. We also identified S. epidermidis, S.saprophyticus and S. xylosus from these isolates using amodified PCR protocol.MATERIALS AND METHODSBACTERIAL STRAINSA total of 2426 staphylococcal related infections wererecorded at the Universiti Kebangsaan Malaysia MedicalCentre (UKMMC) in 2009. Index isolates from these caseswere collected and established as strains. Strains that wereidentified as CoNS via coagulase and Dnase test were thenstocked at -80°C in Brain Heart Infusion broth (Oxoid ltd,England) and 40% glycerol from time of isolation for furtheruse.1* Correspondence to: sawati@ppukm.ukm.myhui-min@ppukm.ukm.my2Nurul Azirah Mohamad Sani et al. Asia. Pac. J. Mol. Med.ANTIMICROBIAL SUSCEPTIBILITY TESTINGTo determine the antibiogram of our collection of CoNSand identify MRCoNS among these isolates, antimicrobialsusceptibility testing was performed for all collected strainsusing disk diffusion method on muller hinton agar (Oxoidltd, England) according to Clinical Laboratory StandardInstitute (CLSI) [6] recommendation. Antibiotics used inthe test include penicillin, erythromyan, oxacilin,gentamicin, ciproflocaxin, mupirocin, fusidic acid,teicoplanin and vancomycin.GENOMIC DNA EXTRACTIONGenomic DNA of tested CoNS was extracted using DNeasyBlood & Tissue Kit (Qiagen USA) according to themanufacturer’s instructions. The concentration and purityof DNA was measured using Nanodrop spectrophotometer(NanoDrop 2000, Thermo Scientific, USA). Extracted DNAwas stored at -20°C till further use.CoNS SPECIES IDENTIFICATIONSpecies identification for our CoNS collections were carriedout using a modified multiplex PCR protocol [7]. Briefly,specific primer pairs Se705-1 and Se705-2; Sap1 and Sap2;XYL-F and XYL-R for CoNS speciesS. epidermidis, S. saprophyticus and S. xylosus respectivelywere used to detect and differentiate between the speciesof tested strains. Nucleotide sequences of each primer arelisted in Table 1. Multiplex PCR was performed under thefollowing conditions: 4 min at 94°C; followed by 30 cyclesof 2 min at 94°C, 1 min at 53°C, 2 min at 72°C; an extraannealing step of 5 min at 72°C and a final hold at 4°C. PCRproducts were analysed by electrophorhesis through a 1.5%agarose gel (Sigma) in 1 x TBE buffer (Figure 1). S.aureuswas used as a negative control for each reaction.Table 1. Nucleotide sequences of primers used in the studyPrimers PCR product size (bp) Sequence (5’–3’) Annealing positions on GeneXyl-F 539 AACGCGCAACGTGATAAAATTAATG 1-25Xyl-R AACGCGCAACAGCAATTACG 539-520Sap 1 221 TCAAAAAGTTTTCTAAAAAATTTAC 169-193Sap 2 ACGGGCGTCCACAAAATCAATAGGA 379-355Se705-1 124 ATCAAAAAGTTGGCGAACCTTTTCA 21-45Se705-2 CAAAAGAGCGTGGAGAAAAGTATCA 145-121221  bp  124  bp108  bp1      2      3         M      4       5        6        7        8          9        10       11Figure 1. Multiplex PCR for CoNS species. Lane M, 100-bp molecular size DNA ladder (Promega); lane 1, negative control S.aureus 81/108 (108bp); lane 2, positive control S. epidermidis C.2 (124bp); lane 3, positive control S. saprophyticus C.1334(221bp); lanes 4-8 & 10-11, S. epidermidis isolates from patient; and lane 9, S. saprophyticus isolate from a patient.RESULTS AND DISCUSSIONCoagulase and Dnase tests on 2426 staphylococcal strainsused in this study revealed that 1142 of these strains wereCoNS, giving a prevalence of 47.1%. From the MPCR, 68.4%of the strains were S. epidermidis, 1.3% wereS. saprophyticus, while 30.3% were from other species. S.epidermidis was also the most prevalent species inMRCoNS (68.1%), followed by S. saprophyticus (1.5%)and other CoNS species (30.3%). On the other hand, some3Nurul Azirah Mohamad Sani et al. Asia. Pac. J. Mol. Med.studies identified S. haemolyticus as the most prevalentCoNS species in their hospitals [8, 9]. The predominanceof S. epidermidis among CoNS and MRCoNS isolates foundin our study is similar to the majority of previous studies[4,10,11,12,13,14]. This is not surprising, as S. epidermidisis the most ubiquitous normal flora of the human body [5]plus the fact that implants and prostheses are easilycontaminated with this species if proper infection controland aseptic techniques were not adhered during surgicalor implant procedures. In the study by Anne et al on 242strains, as many as 67.4% strains were found to be S.epidermidis, while no S. saprophyticus isolate was detected[11].Conventional phenotypic tests such as oxidation/fermentation of glucose in Hugh/Leifson medium, Voges-Proskauer reaction and susceptibility to novobiocin havelong been established for the identification ofStaphylococcus species [15,16]. However, these testsyielded false positive and false negative results frequently[15,16,17,18]. With the development of moleculartechniques, specific nucleotide sequences could now beused as targets for molecular identification ofStaphylococcus species. For example, Poyart et al. (2001)successfully developed a pair of degenerate primers thatamplified an internal fragment of the staphylococcal sodAgene, which could then be sequenced to discriminate mostof the Staphylococci [19]. Sequencing of the hsp60 andrpoB genes have also been reported to be useful fortaxonomic and phylogenetic studies of Staphylococcus[20,21]. Nevertheless, these methods are time consumingand costly, as sequencing of the amplified products isrequired for species identification.In order to simplify the process of species identificationin Staphylococci, primers have been developed for species-specific detection of S. aureus [17,18,22], S. epidermidis[10,17], S. saprophyticus [23] and S. xylosus [16,17,24,25].Some studies employed a multiplex PCR protocol thatassociates several primer pairs specific for various targetsin the same amplification reaction. Martineau et al. (1998)developed a multiplex PCR assay which identifies S. aureusand S. epidermidis [18]; while Mason et al. (2001)’s protocol[22] could discriminate staphylococci from other genuses,distinguish S. aureus from CoNS and also identify oxacillinresistant staphylococci. In a separate research, Vannuffelet al. (1999) proposed a multiplex PCR-reverse hybridizationapproach targeting the femA gene in order to identify clinicalstaphylococcal species [26]. The researchers characterizeda femA homologous gene in S. epidermidis and assessedthe presence of femA homologous genes in S. hominis andS. saprophyticus by alignment of S. epidermidis femAsequences. For our study, we modified the multiplex PCRprotocol from Morot-Bizot et al. [7] to identify anddifferentiate S. epidermidis, S. saprophyticus and S. xylosusin our collection of CoNS isolates. The protocol proved tobe effective and time saving for CoNS identification.In addition to species identification, antimicrobialsusceptibility testing using various antibiotics prescribedin our medical centre was also performed for all CoNS. Noisolate was found to be resistant to vancomycin;nevertheless, about 60% of the CoNS were resistant tocommonly prescribed antibiotics such as erythromycin andoxacillin/methicillin. In addition, almost all of the strains(98.7%) were resistant to penicillin (Figure 2). CoNS havebeen documented to be inherently resistant to penicillinsand cephalosporins [13,16], and there have been concernsthat heavy, prolonged usage of these antibiotics in certainhospitals may select for multidrug-resistant commensalorganisms such as methicillin resistant Staphylococcusepidermidis (MRSE). Therefore, proper antibioticstewardship would be of crucial importance in medicalcentres recording a high percentage of multidrug-resistantCoNS.0%20%40%60%80%100%Antibiotic susceptibility testing of CoNSNot DetectedRes istantSusceptibleVancomycinTeicoplaninMupirocinOxacillin/MethicillinPenicillinGentamicinFusidic acidErythromycinCiprofloxacinFigure 2. Antibiotic susceptibility testing for CoNS isolates used in the study4Nurul Azirah Mohamad Sani et al. Asia. Pac. J. Mol. Med.CONCLUSIONS. epidermidis was the most prevalent CoNS speciesidentified in UKMMC in 2009; 57.7% of these isolates weremethicillin resistant. As vancomycin is the standardtreatment given for methicillin resistant S. epidermidis(MRSE), a high prevalence of MRSE might increase theselection pressure for vancomycin resistantStaphylococcus species and lead to limited treatmentoptions in the future. Compared to conventional phenotypictests, the multiplex PCR employed in this study is moreaccurate and rapid to perform, allowing CoNS speciesidentification in atimely and reliable manner.ACKNOWLEDGEMENTThis research is supported by the UKM ResearchUniversity Grant UKM-GUP-TKP-08-19-067.REFERENCES1. Ryan KJ, Ray CG (editors). Sherris Medical Microbiology(4th ed.). McGraw Hill 2004. ISBN 0838585299.2. Almudena Rodríguez-Aranda, Maria Daskalaki, Julia Villar,Francisca Sanz, Joaquín, R. Otero and Fernando Chaves.Nosocomial spread of linezolid-resistant Staphylococcushaemolyticus infections in an intensive care unit. DiagnosticMicrobiology and Infectious Disease’s Journal 2009; 63:398-402.3. Weisman L. E. Coagulase-negative staphylococcal disease:emerging therapies for the neonatal and pediatric patient.CABI Abstract. 2002.4. Walton D., Shields A., Reece K. and Bittner T. Comparisonof Coagulase negative staphylococcus species identificationusing automated rep-PCR and sodA sequencing. AmericanSociety for Microbiology 2004; 104.5. Kloos, W. Taxonomy and systematics of Staphylococciindigeneous to humans. In: Crossley KB, Archer GL eds.The Staphylococci in human disease. New York: ChurchillLivingstone. 1997.6. Clinical and Laboratory Standards Institute (CLSI):Performance Standards for Antimicrobial SusceptibilityTesting. 16th Informational Supplement. CLSI documentM100-S16. Wayne, PA 2006.7. S. Corbiere Morot-Bizot, R. Talon and S. Leroy.Development of a multiplex PCR for the identification ofStaphylococcus genus and four staphylococcal speciesisolated from food Journal of Applied Microbiology 2004;97: 1087-1094.8. Mehdinejad M, Sheikh AF, Jolodar A. Study of methicillinresistance in staphylococcus aureus and species of coagulasenegative staphylococci isolated from various clinicalspecimens, Pak J Med Sci 2008; 24(5): 719-724.9. Amita Jain, Jyotsna Agarwal and Seema Bansal. Prevalenceof methicillin-resistant, coagulasenegative staphylococci inneonatal intensive care units: findings from a tertiary carehospital in India Journal of Medical Microbiology 2004; 53:941-94410. Martineau, F., Picard, F., Roy, P., Ouellette, M. and Bergeron,M. Species-specific and ubiquitous DNA-based assays forrapid identification of Staphylococcus epidermidis, Journalof Clinical Microbiology 1996; 34: 2888-2893.11. Anne B. P., Robert S. and Lars V. P. Detection of methicillinresistance in Coagulase-negative staphylococci and instaphylococci directly from stimulated blood culture usingthe EVIGENE MRSA Detection Kit, Journal ofAntimicrobial Chemotherapy 2003; 51: 419-421.12. Huebner J., Goldman DA. Coagulase-negative staphylococci:role as pathogens. Annu Rev Med 1999; 50: 223-236.13. PE Akpaka, N Christian, NC Bodonaik, MC Smikle.Epidemiology of Coagulase-Negative Staphylococcusisolated from clinical blood specimens at UniversityHospital of the West India. West Indian Med J 2006;55(3): 170.14. Kenneth L. Muldrew, Yi-Wei Tang, Haijing Li and CharlesW. Stratton. Clonal Dissemination of Staphylococcusepidermidis in an Oncology Ward. Journal of ClinicalMicrobiology 2008; 46(10): 3391-3396.15. Rossi, F., Tofalo, R., Torriani, S. and Suzzi, G. Identificationby 16S-23S rDNA intergenic region amplification,genotypic and phenotypic clustering of Staphylococcusxylosus strains from dry sausages. Journal of AppliedMicrobiology 2001; 90: 365-371.16. Morot-Bizot, S., Talon, R. and Leroy-Setrin, S.Development of specific PCR primers for a rapid andaccurate identification of Staphylococcus xylosus, a speciesused in food fermentation. Journal of MicrobiologicalMethods 2003; 55: 279-286.17. Forsman, P., Tilsala-Timisjarvi, A. and Alatossava T.Identification of staphylococcal and streptococcal causes ofbovine mastitis using 16S-23S rRNA spacer regions. Journalof Clinical Microbiology 1997; 143: 3491-3500.18. Martineau, F., Picard, F.J., Roy, P.H., Ouellette, M. andBergeron M.G. Species-specific and ubiquitous-DNA-basedassays for rapid identification of Staphylococcus aureus.Journal of Clinical Microbiology 1998; 36: 618-623.19. Claire Poyart, Gilles Quesne, Claire Boumaila and PatrickTrieu-Cout. Rapid and Accurate Species-Level Identificationof Coagulase- Negative Staphylococci by using the sodAGene as a Target. Journal of Clinical Microbiology 2001;39(12): 4296-4301.20. Anita Y. C. Kwok and Anthony W. Chow.  Phylogeneticstudy of Staphylococcus and Macrococcus speciesbased on partial hsp60 gene sequences. InternationalJournal of Systematic and Evolutionary Microbiology2003; 53: 87-92.21. Michel Drancourt and Didier Raoult rpoB Gene Sequence-Based Identification of Staphylococcus Species. Journalof Clinical Microbiology 2002; 40(4): 1333-1338.22. Mason, W.J., Blevins, J.S., Beenken, K., Wibowo, N., Ojha,N. and Smeltzer, M.S. Multiplex PCR protocol for thediagnosis of staphylococcal infection. Journal of ClinicalMicrobiology 2001; 39: 3332-3338.23. Martineau, F., Picard, F.J., Menard, C., Roy, P.H., Ouellette,M. and Bergeron, M.G. Development of a rapid PCR assayspecific for Staphylococcus saprophyticus and applicationto direct detection from urine samples, Journal of ClinicalMicrobiology 2000; 38: 3280-3284.5Nurul Azirah Mohamad Sani et al. Asia. Pac. J. Mol. Med.24. Aymerich, T., Martin, B., Garriga, M. and Hugas, M.Microbial quality and direct PCR identification of lacticacid bacteria and nonpathogenic staphylococci from artisanallow-acid sausages. Applied and Environmental Microbiology2003; 69: 4583-4594.25. Blaiotta, G., Pennacchia, C., Parente, E. and Villani, F. Designand evaluation of specific PCR primers for rapid and reliableidentification of Staphylococcus xylosus strains isolated fromdry fermented sausages. Systematic and AppliedMicrobiology 2003; 26: 601-610.26. Pascal Vannuffela, Michel Heusterspreutea, MichèleBouyerc, Bernard Vandercamb, Marianne Philippea, Jean-Luc Galaa. Molecular characterization of femA fromStaphylococcus hominis and Staphylococcus saprophyticus,and femA-based discrimination of staphylococcal species.Res. Microbiol 1999; 150: 129-141.

Species identification of Coagulase Negative Staphylococci (CoNS) isolates in Universiti Kebangsaan Malaysia Medical Centre (UKMMC)

Abstract

Similar works

Full text

Available Versions

UKM Journal Article Repository