de Lange, Jon

Fraaije, Marco W.

Mihovilovic, Marko D.

Pazmino, Daniel E. Torres

Riebel, Anette

Rudroff, Florian

Dissertations of the University of Groningen

   University of GroningenEfficient Biooxidations Catalyzed by a New Generation of Self-Sufficient Baeyer-VilligerMonooxygenasesPazmino, Daniel E. Torres; Riebel, Anette; de Lange, Jon; Rudroff, Florian; Mihovilovic,Marko D.; Fraaije, Marco W.Published in:ChemBioChemDOI:10.1002/cbic.200900480IMPORTANT NOTE: You are advised to consult the publisher's version (publisher's PDF) if you wish to cite fromit. Please check the document version below.Document VersionPublisher's PDF, also known as Version of recordPublication date:2009Link to publication in University of Groningen/UMCG research databaseCitation for published version (APA):Pazmino, D. E. T., Riebel, A., de Lange, J., Rudroff, F., Mihovilovic, M. D., & Fraaije, M. W. (2009). EfficientBiooxidations Catalyzed by a New Generation of Self-Sufficient Baeyer-Villiger Monooxygenases.ChemBioChem, 10(16), 2595-2598. https://doi.org/10.1002/cbic.200900480CopyrightOther than for strictly personal use, it is not permitted to download or to forward/distribute the text or part of it without the consent of theauthor(s) and/or copyright holder(s), unless the work is under an open content license (like Creative Commons).The publication may also be distributed here under the terms of Article 25fa of the Dutch Copyright Act, indicated by the “Taverne” license.More information can be found on the University of Groningen website: https://www.rug.nl/library/open-access/self-archiving-pure/taverne-amendment.Take-down policyIf you believe that this document breaches copyright please contact us providing details, and we will remove access to the work immediatelyand investigate your claim.Downloaded from the University of Groningen/UMCG research database (Pure): http://www.rug.nl/research/portal. For technical reasons thenumber of authors shown on this cover page is limited to 10 maximum.             Supporting Information  © Copyright Wiley-VCH Verlag GmbH & Co. KGaA, 69451 Weinheim, 2009    DOI: 10.1002/cbic.200900480  Supporting Information  for  Efficient Biooxidations Catalyzed by a New Generation of Self-Sufficient Baeyer-Villiger Monooxygenases  Daniel E. Torres Pazmiño, Anette Riebel, Jon de Lange, Florian Rudroff,  Marko D. Mihovilovic, and Marco W. Fraaije   Contents  Overexpression of CRE2/BVMOs Cloning Strategy CRE2−PAMO linker variants Overexpression and fusion enzyme purification Thermostability measurements of CRE2−PAMO linker variants Overexpression of CRE2/BVMOs Expression of the new generation of self-sufficient BVMOs in Escherichia coli TOP10 yielded up to 50 mg of pure and soluble CRE2/BVMO from 1 L culture broth. In com-parison to the previous generation of self-sufficient BVMOs, similar protein expres-sion levels were obtained (Figure S1).  Figure S1 . Soluble overexpression of CRE2/BVMOs in cell-free extract (CFE) of E. coli TOP10, visualized by a 12 % SDS-PAGE gel. Lane 1 and 7  LMW marker (BioRad), lane 2 CRE2−PAMO, lane 3 CRE2−CHMO, lane 4 CRE2−CPMO, lane 5 CRE2−HAPMO, lane 6 CRE2−EtaA.  Cloning Strategy pCRE2−PAMO linker variants For the creation of pCRE2−PAMO linker variants 1 and 2, the original linker was re-moved using XhoI and PvuII restricition sites. The linearized vector was subsequently treated with Antarctica Phosphatase (New England Biolabs) according to the manu-facturer’s guidelines. The linker fragments were created using 5’-phosphorylated complementary primers (Table S1). These primers were dimerized in a thermocycler by incubating 100 µM of each primer in 10 mM Tris/HCl (pH 8.5) at 72 ºC for 2 min, followed by a slow cooling down to 23 °C in 45 min.  The resulting double-stranded DNA was then ligated to the linearized vector using T4 DNA ligase (New England Biolabs).    1      2     3      4     5      6     7 97 kDa  66 kDa  45 kDa  30 kDa   20 kDa  14 kDa Table S1 . Linker fragments used to prepare pCRE2−PAMO linker variants 1 and 2.  Linker variant Nucleotide sequence (5’ → 3’) Variant 1 (glycine-rich) P-tcgagtggtggctctggtgggagcggtggctcag  P-ctgagccaccgctcccaccagagccaccac Variant 2 (random, “nature-preferred”) P-tcgagtgccaccggtagcgcgacgggctcag  P-ctgagcccgtcgcgctaccggtgccac  Linker variant 3 was created by amplifying the PTDH mutant gene and ligating in this amplified product in the NdeI/PvuII restricted pCRE2−PAMO vector. Prior to ligation, the PCR product was digested with NdeI. Subsequently, one nucleotide from the linker sequence was removed using the QuikChange® Site-directed Mutagenesis Kit from Stratagene. Primers used for both amplification and mutagenesis are shown in Table S2.  Table S2  Forward and reverse primers for PCR amplification and subsequent site-directed mutagenesis of the PTDH mutant gene. Variant 3 (short) Nucleotide sequence (5’ → 3’) PCR forward primer ggcagccatatgctgccg PCR reverse primer tcagccgcagggttggc QuikChange forward primer gccaaccctgcggctgactggatggccgggcagacg QuikChange reverse primer cgtctgcccggccatccagtcagccgcagggttggc  Overexpression and fusion enzyme purification All CRE2−PAMO linker variants were overexpressed in E. coli TOP10 using Terrific Broth (TB) medium containing 50 µg mL-1 ampicillin and 0.02 % (w/v) L-arabinose. The CRE2−PAMO linker variants were overexpressed at 24 °C during 36 h. There-after, cells were harvested, washed and resuspended in 50 mM Tris/HCl, pH 7.5 con-taining 10 µM FAD. After breaking the cells by ultrasonication and removing cell de-bris by centrifugation, fusion enzymes were purified using 2 mL Ni-NTA column. After purification, excess of imidazole was removed using an Econo-PAC 10DG desalting column (BioRad). The fusion enzymes were concentrated by ultrafiltration and stored at −80 ºC in their resuspension buffers.   Thermostability measurements of CRE2−PAMO linker va riants Thermostability of the enzymes was determined by incubating approximately 10 µM of enzyme in the presence of 10 µM of FAD at 55 °C, after which their remaining ac-tivity was determined at 25 °C using saturating sub strate concentrations. The CRE2− PAMO linker variants contained one of the following peptide sequences as linker:  Table 3  Amino acid sequence of the different CRE2-PAMO linker variants. Linker variant Peptide sequence Normal SRSAAG Variant 1 (glycine-rich) SSGGSGGSGGSAG Variant 2 (random, “nature-preferred”) SSATGSATGSAG Variant 3 (short) W  The remaining activity of both subunits of the CRE2−PAMO linker variants was fol-lowed in time:   Figure S1 . The residual activity of the PAMO subunit of CRE2−PAMO containing different linker variants at 55 °C. The following life-times (t½, 55 ºC) were determined for these variants; a) original linker, 208 min-1; b) short linker, 333 min-1; c) glycine-rich linker, 400 min-1; d) nat-ure-preferred linker, 264 min-1.    Figure S2 . The residual activity of the PTDH subunit of CRE2−PAMO containing different linker variants at 55 °C. The following life-times (t½, 55 ºC) were determined for these variants; a) original linker, 142 min-1; b) short linker, 208 min-1; c) glycine-rich linker, 212 min-1; d) nat-ure-preferred linker, 156 min-1.   

English

Efficient Biooxidations Catalyzed by a New Generation of Self-Sufficient Baeyer-Villiger Monooxygenases

Proceedings - University of Groningen

NARCIS 

University of Groningen Research Database

  
 University of Groningen
Efficient Biooxidations Catalyzed by a New Generation of Self-Sufficient Baeyer-Villiger
Monooxygenases
Pazmino, Daniel E. Torres; Riebel, Anette; de Lange, Jon; Rudroff, Florian; Mihovilovic,
Marko D.; Fraaije, Marco
Published in:
ChemBioChem
DOI:
10.1002/cbic.200900480
IMPORTANT NOTE: You are advised to consult the publisher's version (publisher's PDF) if you wish to cite from
it. Please check the document version below.
Document Version
Publisher's PDF, also known as Version of record
Publication date:
2009
Link to publication in University of Groningen/UMCG research database
Citation for published version (APA):
Pazmino, D. E. T., Riebel, A., de Lange, J., Rudroff, F., Mihovilovic, M. D., & Fraaije, M. W. (2009). Efficient
Biooxidations Catalyzed by a New Generation of Self-Sufficient Baeyer-Villiger Monooxygenases.
ChemBioChem, 10(16), 2595-2598. DOI: 10.1002/cbic.200900480
Copyright
Other than for strictly personal use, it is not permitted to download or to forward/distribute the text or part of it without the consent of the
author(s) and/or copyright holder(s), unless the work is under an open content license (like Creative Commons).
Take-down policy
If you believe that this document breaches copyright please contact us providing details, and we will remove access to the work immediately
and investigate your claim.
Downloaded from the University of Groningen/UMCG research database (Pure): http://www.rug.nl/research/portal. For technical reasons the
number of authors shown on this cover page is limited to 10 maximum.
Download date: 10-02-2018
 
 
 
 
 
 
 
 
 
 
 
 
 
Supporting Information 
 
© Copyright Wiley-VCH Verlag GmbH & Co. KGaA, 69451 Weinheim, 2009 
 
 
 
DOI: 10.1002/cbic.200900480 
 
Supporting Information 
 
for 
 
Efficient Biooxidations Catalyzed by a New Generation of Self-Sufficient 
Baeyer-Villiger Monooxygenases 
 
Daniel E. Torres Pazmiño, Anette Riebel, Jon de Lange, Florian Rudroff,  
Marko D. Mihovilovic, and Marco W. Fraaije 
 
 
Contents 
 
Overexpression of CRE2/BVMOs 
Cloning Strategy CRE2−PAMO linker variants 
Overexpression and fusion enzyme purification 
Thermostability measurements of CRE2−PAMO linker variants 
Overexpression of CRE2/BVMOs 
Expression of the new generation of self-sufficient BVMOs in Escherichia coli TOP10 
yielded up to 50 mg of pure and soluble CRE2/BVMO from 1 L culture broth. In com-
parison to the previous generation of self-sufficient BVMOs, similar protein expres-
sion levels were obtained (Figure S1). 
 
Figure S1. Soluble overexpression of CRE2/BVMOs in cell-free extract (CFE) of E. coli 
TOP10, visualized by a 12 % SDS-PAGE gel. Lane 1 and 7  LMW marker (BioRad), lane 2 
CRE2−PAMO, lane 3 CRE2−CHMO, lane 4 CRE2−CPMO, lane 5 CRE2−HAPMO, lane 6 
CRE2−EtaA. 
 
Cloning Strategy pCRE2−PAMO linker variants 
For the creation of pCRE2−PAMO linker variants 1 and 2, the original linker was re-
moved using XhoI and PvuII restricition sites. The linearized vector was subsequently 
treated with Antarctica Phosphatase (New England Biolabs) according to the manu-
facturer’s guidelines. The linker fragments were created using 5’-phosphorylated 
complementary primers (Table S1). These primers were dimerized in a thermocycler 
by incubating 100 µM of each primer in 10 mM Tris/HCl (pH 8.5) at 72 ºC for 2 min, 
followed by a slow cooling down to 23 °C in 45 min.  The resulting double-stranded 
DNA was then ligated to the linearized vector using T4 DNA ligase (New England 
Biolabs). 
 
  1      2     3      4     5      6     7 
97 kDa 
 
66 kDa 
 
45 kDa 
 
30 kDa 
 
 
20 kDa 
 
14 kDa 
Table S1. Linker fragments used to prepare pCRE2−PAMO linker variants 1 and 2.  
Linker variant Nucleotide sequence (5’ → 3’) 
Variant 1 (glycine-rich) P-tcgagtggtggctctggtgggagcggtggctcag 
 P-ctgagccaccgctcccaccagagccaccac 
Variant 2 (random, “nature-preferred”) P-tcgagtgccaccggtagcgcgacgggctcag 
 P-ctgagcccgtcgcgctaccggtgccac 
 
Linker variant 3 was created by amplifying the PTDH mutant gene and ligating in this 
amplified product in the NdeI/PvuII restricted pCRE2−PAMO vector. Prior to ligation, the 
PCR product was digested with NdeI. Subsequently, one nucleotide from the linker sequence 
was removed using the QuikChange® Site-directed Mutagenesis Kit from Stratagene. 
Primers used for both amplification and mutagenesis are shown in Table S2. 
 
Table S2 Forward and reverse primers for PCR amplification and subsequent site-
directed mutagenesis of the PTDH mutant gene. 
Variant 3 (short) Nucleotide sequence (5’ → 3’) 
PCR forward primer ggcagccatatgctgccg 
PCR reverse primer tcagccgcagggttggc 
QuikChange forward primer gccaaccctgcggctgactggatggccgggcagacg 
QuikChange reverse primer cgtctgcccggccatccagtcagccgcagggttggc 
 
Overexpression and fusion enzyme purification 
All CRE2−PAMO linker variants were overexpressed in E. coli TOP10 using Terrific 
Broth (TB) medium containing 50 µg mL-1 ampicillin and 0.02 % (w/v) L-arabinose. 
The CRE2−PAMO linker variants were overexpressed at 24 °C during 36 h. There-
after, cells were harvested, washed and resuspended in 50 mM Tris/HCl, pH 7.5 con-
taining 10 µM FAD. After breaking the cells by ultrasonication and removing cell de-
bris by centrifugation, fusion enzymes were purified using 2 mL Ni-NTA column. After 
purification, excess of imidazole was removed using an Econo-PAC 10DG desalting 
column (BioRad). The fusion enzymes were concentrated by ultrafiltration and stored 
at −80 ºC in their resuspension buffers.  
 
Thermostability measurements of CRE2−PAMO linker variants 
Thermostability of the enzymes was determined by incubating approximately 10 µM 
of enzyme in the presence of 10 µM of FAD at 55 °C, after which their remaining ac-
tivity was determined at 25 °C using saturating sub strate concentrations. The CRE2− 
PAMO linker variants contained one of the following peptide sequences as linker: 
 
Table 3 Amino acid sequence of the different CRE2-PAMO linker variants. 
Linker variant Peptide sequence 
Normal SRSAAG 
Variant 1 (glycine-rich) SSGGSGGSGGSAG 
Variant 2 (random, “nature-preferred”) SSATGSATGSAG 
Variant 3 (short) W 
 
The remaining activity of both subunits of the CRE2−PAMO linker variants was fol-
lowed in time: 
 
 
Figure S1. The residual activity of the PAMO subunit of CRE2−PAMO containing different 
linker variants at 55 °C. The following life-times (t½, 55 ºC) were determined for these variants; 
a) original linker, 208 min-1; b) short linker, 333 min-1; c) glycine-rich linker, 400 min-1; d) nat-
ure-preferred linker, 264 min-1.  
 
 Figure S2. The residual activity of the PTDH subunit of CRE2−PAMO containing different 
linker variants at 55 °C. The following life-times (t½, 55 ºC) were determined for these variants; 
a) original linker, 142 min-1; b) short linker, 208 min-1; c) glycine-rich linker, 212 min-1; d) nat-
ure-preferred linker, 156 min-1.  
 


University of Groningen

ARTS repository - University of Groningen

https://pure.rug.nl/ws/files/6738720/2009ChemBioChemTorresPazminoSupp.pdf

Efficient Biooxidations Catalyzed by a New Generation of Self-Sufficient Baeyer-Villiger Monooxygenases

Abstract

Similar works

Full text

Available Versions

Dissertations of the University of Groningen

Proceedings - University of Groningen

Proceedings - University of Groningen

NARCIS

University of Groningen Research Database

University of Groningen

University of Groningen

ARTS repository - University of Groningen

Dissertations of the University of Groningen

ARTS repository - University of Groningen