RNA silencing is a part of the plant innate immune system that could effectively cope with intruders, like viruses. However, viruses evolved proteins that can suppress RNA silencing thus supporting virus spreading in the host. To counteract RNA silencing, suppressor proteins attack different players of RNA silencing pathway. The P1 protein of the Sweet potato mild mottle virus binds and inactivates small RNA loaded RISC complexes. Using a deletion series in the P1 protein we aimed to identify the possible smallest working version of P1. Our results revealed that the minimal RNA silencing suppressor domain of P1 is as small as 210 amino acids in size

Kemény, Lajos

Lakatos, Lóránt

Szabó, Edit Zsuzsanna

English

Szabó Edit Zsuzsanna

Kemény Lajos

Lakatos Lóránt

University of Szeged

Volume 58(2):163-166, 2014Acta Biologica Szegediensishttp://www2.sci.u-szeged.hu/ABSArticle1Department of Dermatology and Allergology, Faculty of Medicine, University of Szeged, Szeged, Hungary, 2MTA-SZTE Dermatological Research Group, Szeged, HungaryDeletion series in the P1 protein of the Sweet potato mild mottle virus identifies the shortest fully functional RNA silencing suppressor domainEdit Zsuzsanna Szabó1, Lajos Kemény1,2, Lóránt Lakatos1,2*ABStrAct                        RNA silencing is a part of the plant innate immune system that could effectively cope with intruders, like viruses. However, viruses evolved proteins that can suppress RNA silencing thus supporting virus spreading in the host. To counteract RNA silencing, suppressor proteins attack different players of RNA silencing pathway. The P1 protein of the Sweet potato mild mottle virus binds and inactivates small RNA loaded RISC complexes. Using a deletion series in the P1 protein we aimed to identify the possible smallest working version of P1. Our results revealed that the minimal RNA silencing suppressor domain of P1 is as small as 210 amino acids in size. Acta Biol Szeged 58(2):163-166 (2014)Key WorDSRNA silencingplantSweet potato mild mottle virusRNA silencing suppressorAccepted Dec 18, 2014*Corresponding author. E-mail: lakatos.lorant@med.u-szeged.hu163RNA silencing is a post-transcriptional gene regulation mechanism conserved in almost all eukaryotes and involved in many essential biological processes, from development, physiological activity to the regulation of abiotic and biotic stress responses by micro RNAs (miRNA), genome defense by 24 nucleotide (nt) long small interfering RNAs (siRNAs) and in particular antiviral defense by 21 nt siRNAs. RNA silencing negatively regulates genes expression (Herr and Baulcombe 2004).The trigger of RNA silencing can be pri-miRNAs for miRNAs or double stranded (ds) RNAs as replicative forms of plant viruses. Trigger RNAs are processed into si- and miRNAs by the RNAse III type enzymes Dicers, then small RNAs are loaded into the Argonaute (AGO) protein contain-ing protein complexes called RNA induced silencing complex (RISC). This process is referred to as RISC assembly. In RISC, one strand of the small RNA is eliminated resulting in the single stranded (ss) small RNA containing RISC complex (active RISC). Active RISC complexes are able to hamper gene expression either by cleaving the target RNA or by inhibiting the translation of the target RNA (Hutvagner and Simard 2008). Thus, Argonaute (AGO) proteins play a key role in RNA silencing.In the last few years, several AGO binding proteins were identified. Most of them contain GW/WG (Gly-Trp/Trp-Gly) domains, which mediate the interaction with AGO. This group of proteins was named GW/WG proteins after the founding member GW182 protein of human. GW182 in animals binds AGO and mediates the interaction with the polyA binding proteins to repress the translation of the target RNA (Pfaff et al. 2013). In Schizosaccharomyces pombe, transcriptional silencing involves AGO and TAS3 that shows high similar-ity to animal GW182 proteins (Pfaff et al. 2013). In plants, heterochromatin silencing exploits a couple of GW/WG proteins, such as the second largest subunit of the RNA poly-merase V complex and SPT5 protein (Bies-Etheve et al. 2009; Herr et al. 2005). Moreover, the GW/WG protein SUO was identified in Arabidopsis thaliana to be involved in miRNA driven RNA silencing (Yang et al. 2012). Thus, these GW/WG proteins have a positive effect on RNA silencing and are absolutely required for the efficient carrying RNA silencing into execution.Two viral proteins bearing WG/GW domains were found to have a negative effect on RNA silencing. The p38 protein of the Turnip crinkle virus (TCV) sequesters small RNA unloaded AGO1 (Azevedo et al. 2010). However, the P1 RNA silencing suppressor protein of the Sweet potato mild mottle virus (SPMMV) is markedly different from that of p38. SPMMV P1 binds AGO1 loaded with si- or miRNAs, thus in-hibiting target cleavage of active RISC complexes. Mutational analysis revealed three WG/GW motifs, resembling the AGO binding platform conserved in plants and metazoans, at the N-terminal part of P1, which are required for AGO binding and silencing suppressor activity (Giner et al. 2010). Recently, we found that the first 383 amino acid (aa) region of the SPMMV P1 renders RNA silencing suppressor activity (Giner et al. 2010). Thus, our aim was to find the smallest region of the P1 protein bearing fully functional sup-pressor activity. Our results based on a series of truncation of 164Szabó et al.the P1 protein from the C-terminal end showed that the 1-210, but not 1-120, amino acids region is fully functional.Materials and MethodsPlant materialsWild-type Nicotiana benthamiana plants grown in soil under normal growth conditions were used for, virus infection and agroinfiltration. Plants were grown in Phytotron (Versatile Environmental Test Chambers; Sanyo, Tokyo, Japan) under a 14-h light (50 mE m±2s±1) and 10-h dark regime at 23 °C.AgroinfiltrationAgroinfiltration was essentially carried out as described ear-lier (Silhavy et al. 2002). Plasmid DNA was introduced into the Agrobacterium tumefaciens C58C1 strain by triparental mating (Wise et al. 2006). Agrobacterium strains harboring the expression plasmids were cultured at 28 °C in LB medium in the presence of 5 µg/ml tetracycline and 100 µg/ml kana-mycin. Cultures were centrifuged at room temperature with 1000 g to pellet the bacteria, then resuspended in the induc-tion solution containing 10 mM MES (pH 5.6), 10 mM MgCl2 and 150 µM acetosyringone. Optical density of the cultures were determined and diluted to an OD600 of 0.3 for suppressor and 0.1 for reporter genes. Diluted and mixed Agrobacterium strains were incubated in the induction solution for 1-3 hours at room temperature before infiltration.Primers used in this study P1-5’-end: 5’GGGGATTCCCTAGAATGGGGAAATCCAAACTC 3’P11-360-3’-end: 5’ TGAATTCTCATGCCACCGTGATGG-GACACACCATAGC 3’P11-305-3’-end: 5’ TGAATTCTCATGTCTTTGTAACCCA-CATAACTGC 3’P11-210-3’-end: 5’ TGAATTCTCAAATTGAGAAAA-CAGTTTCCTCAAAAACC 3’P11-120-3’-end: 5’ TGAATTCTCAGTTATCAAGTACAT-TGTCGTCGCGCTTGTT 3’Western blot analysisTo the blot analysis, samples were collected in 2 cm diameter. The samples were extracted in 2x sodium dodecyl sulfate (SDS) loading puffer and boiled for 5 minutes, after sample preparation 10% sodium dodecyl sulfate polyacrylamide gel electrophoresis (SDS-PAGE) was run. Blocking was carried out in 5% dry milk in phosphate buffered saline (PBS) at every turn. Anti-HA (anti-influenza hemagglutinin, 1:3000 in 5% dry milk) and anti-GFP (anti-green fluorescent protein, 1:5000) was used for HA and GFP tagged samples, respec-tively. Anti rabbit HRP (anti-rabbit IgG conjugated to horse-radish peroxidase, 1:5000) was used as secondary antibody. At the co-immunoprecipitation anti-Ha and anti-myc antibody was used (1:5000 in 2% dry milk; secondary antibody was anti-rabbit HRP, 1:5000).results and DiscussionIt was previously demonstrated that the N-terminal 383 amino acid region of SPMMV P1 possessed the silencing suppressor domain (Giner et al. 2010). If the N-terminally HA-tagged full length SPMMV P1 was infiltrated into N. benthamiana plants and immunoprecipitated, the minority of the HA-tagged protein was proven full length (Lakatos, unpublished). This result might not be surprising, since it is already known that Figure 1. RNA silencing suppressor activity of the truncated mutants. The first panel shows empty vector infiltrated sample, used as negative control. The mutant of interest was infiltrated as shown in the second, third and fourth panel. On the right side of each panel P11-383 was infiltrated, as positive control.165Determination of the silencing suppressor domainmaturation of the huge potyviral polypeptide translated occurs via the intrinsic protease activities of the polypeptide. Even P1 has a protease domain in its C-terminal, which is required for liberation of P1 from the primary translation product (Valli et al. 2007). Thus, the C-terminal truncation of P1 can be a consequence of its own protease activity, but the action of the plant proteases could not be excluded. Our aim was to find out, whether these shorter versions of P1 still have RNA silencing suppressor activity. To answer this question, we systematically performed C-terminal trunca-tions on the SPMMV P1 protein. To this end, we amplified the P1 coding region with P1-5’-end primer (annealing to the translational start codon) and P11-360-, P11-305-, P11-210- and P11-120-3’-end primers resulting in 360-, 305-, 210- and 120-aa versions of P1. PCR products were cloned into the TOPO II vector (Invitrogen) and sequenced from both sides. These in-serts were cloned into pSanyi plant expression vector (Kertesz et al. 2006) to express them as fusion protein with a HA-tag at their N-terminal end. Agrobacterium strains harboring these constructs were coinfiltrated with reporter construct GFP-171.1 (Parizotto et al. 2004) to check for silencing suppres-sor activity in N. benthamiana (Giner et al. 2010). SPMMV P11-383 was used as a control, because this truncated version was known to have silencing suppressor activity. Forty eight hours post-infiltration, visual inspection of the infiltrated leaves was carried out under UV light. We found that the SPMMV P11-383, P11-360, P11-305, and P11-210 infiltrated leaves showed bright green fluorescence under UV light, indicat-ing RNA silencing suppressor activity. However, the P11-120 infiltrated leaves were rather red, which demonstrated lack of silencing suppressor activity (Fig. 1). Then, Western blot-ting was carried out to detect GFP protein in the infiltrated leaves. Consistently with our visual inspection, strong GFP expression was found in the protein extracts of P11-383, P11-360, P11-305, and P11-210 infiltrated leaves, while significantly less GFP was detected, when GFP-171 or GFP-171 and P11-120 were infiltrated (Fig. 2A). These experiments clearly revealed that silencing suppressor function was lost in the case of the P11-120 mutant. We showed earlier that SPMMV P1 contains three WG/GW motifs at positions 15, 101 and 131 (Giner et al. 2010). Although, we found that changing W131 to A (alanine) did not significantly affect the silencing suppres-sor function, but in the case of the P11-120 mutant, excluding W131 and ten more amino acids might be detrimental for silencing suppressor activity (Giner et al. 2010). Finally, the expression of the N-terminally HA-tagged truncated silencing suppressor proteins were examined by western blotting. Our results showed that extracts of leaves infiltrated with P11-210, P11-305, P11-360, and P11-383 showed high suppressor expression in increasing protein size (Fig 2B). On the other hand, leaves infiltrated with P11-120 did not express the corresponding pro-tein. Of note, that extracts used in this experiment contained nearly the same amount of protein, as shown in the protein loading panel (Figure 2B). However, the SPMMV P11-120 protein, which did not show suppressor activity, could be detected only when they coinfiltrated in plants with Tobacco etch virus HC-Pro (data not shown) (Azevedo et al. 2010; Szabo et al. 2012).Figure 2. Expression analysis of GFP and the truncated suppressor mutants. Panel A, GFP detected by anti-GFP polyclonal antibody; lanes: 1, empty vector+GFP171; 2, GFP-171+ P11-383; 3, GFP-171+ P11-120; 4, GFP-171+ P11-210, 4 GFP-171+ P11-305, 5, GFP-171+ P11-360; GFP-171+ P11-383. Panel B, suppressor mutants detected by anti-HA antibody; lanes: 1, GFP-171+ P11-120; 2 GFP-171+ P11-210; 3 GFP-171+ P11-305; 4 GFP-171+ P11-360; GFP-171+ P11-383; lower panel represents the loading control.166Szabó et al.The prototype RNA silencing suppressor inhibiting preas-sembled RISC is the SPMMV P1 protein, which consists of 759 amino acids. As it was shown before, this large protein in size contains the RNA silencing suppressor domain at the N-terminal part (Giner et al. 2010) and a protease domain conserved in the Potivirideae family (Valli et al. 2007). Shorter versions of P1 were found in unrelated experiments implicated the functionality of these proteins. Thus, we nar-rowed the silencing suppressor domain to the N-terminal 210 amino acids of SPMMV P1. This truncated protein has full silencing suppressor activity, compared to longer versions. AcknowledgmentsThis study was supported by the Hungarian Research Fund (OTKA) grants (NN107787 and NN11024) to LL. LK was funded by the European Union and co-financed by the Euro-pean Social Fund (TÁMOP-4.2.2.A-11/1/KONV-2012-0035 and TÁMOP 4.2.4.A-2013/2-A2-SZJÖ-TOK-13.referencesAzevedo J, Garcia D, Pontier D, Ohnesorge S, Yu A, Garcia S, Braun L, Berg-doll M, Hakimi MA, Lagrange T, Voinnet O (2010) Argonaute quenching and global changes in Dicer homeostasis caused by a pathogen-encoded GW repeat protein. Genes Dev 24:904-915.Bies-Etheve N, Pontier D, Lahmy S, Picart C, Vega D, Cooke R, and Lagrange T (2009) RNA-directed DNA methylation requires an AGO4-interacting member of the SPT5 elongation factor family. EMBO Rep 10:649-654.Giner A, Lakatos L, Garcia-Chapa M, Lopez-Moya JJ, Burgyan J (2010) Viral protein inhibits RISC activity by argonaute binding through con-served WG/GW motifs. PLoS Pat 6:e1000996.Herr AJ, Baulcombe DC (2004) RNA silencing pathways in plants. Cold Spring Harbor Symposia on Quantitative Biology 69:363-370.Herr AJ, Jensen MB, Dalmay T, Baulcombe DC (2005) RNA polymerase IV directs silencing of endogenous DNA. Science 308:118-120.Hutvagner G, Simard MJ (2008) Argonaute proteins: key players in RNA silencing. Nat Rev Mol Cell Biol 9:22-32.Kertesz S, Kerenyi Z, Merai Z, Bartos I, Palfy T, Barta E, Silhavy D (2006) Both introns and long 3’-UTRs operate as cis-acting elements to trigger nonsense-mediated decay in plants. Nucleic Acids Res 34:6147-6157.Parizotto EA, Dunoyer P, Rahm N, Himber C, Voinnet O (2004) In vivo investigation of the transcription, processing, endonucleolytic activity, and functional relevance of the spatial distribution of a plant miRNA. Genes Dev 18:2237-2242.Pfaff J, Hennig J, Herzog F, Aebersold R, Sattler M, Niessing D, Meister G (2013) Structural features of Argonaute-GW182 protein interactions. Proc Nat Acad Sci U S A 110:E3770-3779.Silhavy D, Molnar A, Lucioli A, Szittya G, Hornyik C, Tavazza M, Burgyan J (2002) A viral protein suppresses RNA silencing and binds silencing-generated, 21- to 25-nucleotide double-stranded RNAs. EMBO J 21:3070-3080.Szabo EZ, Manczinger M, Goblos A, Kemeny L, Lakatos L (2012) Switching on RNA silencing suppressor activity by restoring argonaute binding to a viral protein. J Virol 86:8324-8327.Valli A, Lopez-Moya JJ, Garcia JA (2007). Recombination and gene dupli-cation in the evolutionary diversification of P1 proteins in the family Potyviridae. J Gen Virol 88:1016-1028.Wise AA, Liu Z, Binns AN (2006) Three methods for the introduction of foreign DNA into Agrobacterium. Methods Mol Biol 343:43-53.Yang L, Wu G, Poethig RS (2012) Mutations in the GW-repeat protein SUO reveal a developmental function for microRNA-mediated translational repression in Arabidopsis. Proc Nat Acad Sci U S A 109:315-320.

Deletion series in the P1 protein of the Sweet potato mild mottle virus identifies the shortest fully functional RNA silencing suppressor domain

http://acta.bibl.u-szeged.hu/34913/3/58163.pdf

Deletion series in the P1 protein of the Sweet potato mild mottle virus identifies the shortest fully functional RNA silencing suppressor domain

Abstract

Similar works

Full text

Available Versions

University of Szeged