Producción CientíficaThe ability to respond to the ligands of toll-like receptors (TLR) could be affected by single nucleotide
polymorphisms in TLR codifying genes. The influence of the polymorphisms TLR2 (R753Q, R677W), TLR4
(D299G, T399I) and CD14 (C-159T) was consecutively studied in 65 patients with infective endocarditis.
The control group (n=66) consisted of healthy volunteers. All the polymorphisms were genotyped by
means of restriction analysis after their amplification. An association between endocarditis and variants
of TLR2 R753Q (P < .001) was observed, but no association with other polymorphisms was found.
The TLR2 R753Q co-dominant (odds ratio=13.33), recessive (odds ratio=9.12) and dominant
(odds ratio=3.65) genotypes showed a positive association with the infective endocarditis phenotype.
The polymorphism TLR2 R753Q was associated with a greater susceptibility towards the development of
infective endocarditis. Further studies are required to validate these results and identify other genetic
risk factors

Bustamante Munguira, Juan

Bustamante, Elena

Flórez, Santiago

López Díaz, Javier

San Román Calvar, José Alberto

Tamayo Gómez, Eduardo

Tellería Orriols, Juan José

Álvarez González, Francisco Javier

Revista Española de Cardiología (English Edition)

Bustamante Munguira, Elena

Repositorio Documental de la Universidad de Valladolid

Rev Esp Cardiol. 2011;64(11):1056–1059Brief reportToll-Like Receptor 2 R753Q Polymorphisms Are Associated With an IncreasedRisk of Infective EndocarditisJuan Bustamante,a,* Eduardo Tamayo,b Santiago Flo´rez,a Juan J. Telleria,c Elena Bustamante,bJavier Lo´pez,d J. Alberto San Roma´n,d and F. Javier A´lvarezea Servicio de Cirugı´a Cardiaca, Instituto de Ciencias del Corazo´n (ICICOR), Hospital Clı´nico Universitario de Valladolid, Valladolid, Spainb Servicio de Anestesiologı´a y Cuidados Crı´ticos, Hospital Clı´nico Universitario de Valladolid, Valladolid, Spainc Instituto de Biologı´a y Gene´tica Molecular (IBGM/CSIC), Universidad de Valladolid, Valladolid, Spaind Servicio de Cardiologı´a, Instituto de Ciencias del Corazo´n (ICICOR), Hospital Clı´nico Universitario de Valladolid, Valladolid, SpaineDepartamento de Farmacologı´a y Terape´utica, Facultad de Medicina, Universidad de Valladolid, Valladolid, SpainArticle history:Received 20 December 2010Accepted 20 February 2011Available online 23 July 2011Keywords:Innate immunitySingle nucleotide polymorphismToll-like receptor 2Infective endocarditisA B S T R A C TThe ability to respond to the ligands of toll-like receptors (TLR) could be affected by single nucleotidepolymorphisms in TLR codifying genes. The inﬂuence of the polymorphisms TLR2 (R753Q, R677W), TLR4(D299G, T399I) and CD14 (C-159T) was consecutively studied in 65 patients with infective endocarditis.The control group (n=66) consisted of healthy volunteers. All the polymorphisms were genotyped bymeans of restriction analysis after their ampliﬁcation. An association between endocarditis and variantsof TLR2 R753Q (P < .001) was observed, but no association with other polymorphisms was found.The TLR2 R753Q co-dominant (odds ratio=13.33), recessive (odds ratio=9.12) and dominant(odds ratio=3.65) genotypes showed a positive association with the infective endocarditis phenotype.The polymorphism TLR2 R753Q was associated with a greater susceptibility towards the development ofinfective endocarditis. Further studies are required to validate these results and identify other geneticrisk factors. 2011 Sociedad Espan˜ola de Cardiologı´a. Published by Elsevier Espan˜a, S.L. All rights reserved.El polimorfismo R753Q del toll-like receptor 2 se asocia a un aumento en el riesgode sufrir endocarditis infecciosaPalabras clave:Inmunidad innataPolimorﬁsmo gene´tico de un solonucleo´tidoToll-like receptor 2Endocarditis infecciosaR E S U M E NLa capacidad para responder a los ligandos de toll-like receptors (TLR) puede verse afectadapor polimorﬁsmos de un solo nucleo´tido en genes que codiﬁcan TLR. Estudiamos la inﬂuencia delos polimorﬁsmos TLR2 (R753Q, R677W), TLR4 (D299G, T399I) y CD14 (C-159T) en 65 pacientesconsecutivos con endocarditis infecciosa. El grupo control (n = 66) estuvo formado por voluntarios sanos.Todos los polimorﬁsmos fueron genotipados mediante ana´lisis de restriccio´n despue´s de suampliﬁcacio´n. Se observo´ asociacio´n de endocarditis con variantes de TLR2 R753Q (p < 0,001) y nose encontro´ asociacio´n con otros polimorﬁsmos. Los genotipos TLR2 R753Q, codominantes (oddsratio = 13,33), recesivo (odds ratio = 9,12) y dominantes (odds ratio = 3,65) mostraron asociacio´n positivacon el fenotipo de endocarditis infecciosa. El polimorﬁsmo TLR2 R753Q se asocio´ a una mayorsusceptibilidad a sufrir endocarditis infecciosa. Son necesarios futuros estudios para validar estosresultados e identiﬁcar otros factores gene´ticos de riesgo. 2011 Sociedad Espan˜ola de Cardiologı´a. Publicado por Elsevier Espan˜a, S.L. Todos los derechos reservados.INTRODUCTIONThe annual incidence of endocarditis is between 15 and 60 casesper million.1,2 The prognosis is poor and has remained steady overthe last 4 decades.2 Even with antibiotic therapy, the mortality rateis more than 30% in most studies, and may be as high as 70% amongcertain high-risk populations.2 The pathogenic mechanism bywhich infection of the endocardium develops is multifactorial.However, hereditary and immune factors may also contribute to itsdevelopment.1,3* Corresponding author: Servicio de Cirugı´a Cardiaca, Instituto de Ciencias delCorazo´n (ICICOR), Hospital Clı´nico Universitario de Valladolid, Ramo´n y Cajal 3,47005 Valladolid, Spain.E-mail address: jbustamantemunguira@gmail.com (J. Bustamante).1885-5857/$ – see front matter  2011 Sociedad Espan˜ola de Cardiologı´a. Published bdoi:10.1016/j.rec.2011.02.027The toll-like receptors (TLRs) are involved in the innate immunesystem. To date, 11 TLRs have been identiﬁed that recognizedistinct pathogen-associated molecular patterns that have beenevolutionarily conserved in speciﬁc classes of microbes. Theseantigens include cell wall components of Gram-positive (bacteriallipoproteins and lipoteichoic acids, detected by TLR2) and Gram-negative (lipopolysaccharide [LPS], detected by TLR4) bacteria.Recognition of LPS involves an LPS receptor complex, of whichCD14 and the TLR4 are important components.4Data suggests that the ability of certain individuals to respondproperly to TLR ligands may be impaired by single nucleotidepolymorphisms (SNPs) within TLR genes, resulting in an alteredsusceptibility to infection or inﬂammation.5 Polymorphisms of theTLR2 R753Q gene have been linked to variations in responses tostaphylococcus6 and polymorphisms of R677W are associatedy Elsevier Espan˜a, S.L. All rights reserved.Figure 1. Electrophoretic migration of the toll-like receptor 2p.R753Qpolymorphism.J. Bustamante et al. / Rev Esp Cardiol. 2011;64(11):1056–1059 1057with an increased susceptibility to leprosy and tuberculosis inAsian populations.7 Two common mutations in the TLR4 gene havebeen described, TLR4 D299G and T399I. These mutations arereportedly linked to an increased risk of Gram-negative bacterialinfections and septic shock.4,8 A polymorphism in the promoterregion of the CD14 gene is associated with an increase inprevalence of Gram-negative bacterial infection.9We hypothesized that polymorphisms in the genes of theseinnate immune receptors are associated with an increase inthe prevalence of infective endocarditis. Here, we examined thefrequency of the TLR2 (R753Q, R677W), TLR4 (D299G, T399I), andCD14 (C-159T) polymorphisms in patients with infective endo-carditis and in healthy controls.METHODSPatients and ControlsSixty-ﬁve patients (57 men, 8 women; mean  standarddeviation age 63.7  11.9 years, range 32-85 years) diagnosedconsecutively with infective endocarditis according to the Dukecriteria were studied from December 2005 to December 2008(ﬂow inclusion of patients: 2006, 22 patients; 2007, 17; 2008, 26).The control group (n = 66) included healthy blood donors (55 men,11 women; age 61.7  10.2 years, range 32-79 years). Patients andcontrols were members of a homogeneous population, all Caucasianand residents of the same region (Castilla y Leo´n, Spain). Eachparticipant gave informed consent for the study, which was approvedby the hospital’s research committee.Genomic DNA Preparation and QuantizationTwo milliliters of whole blood samples were collected inethylenediaminetetraacetic acid-coated tubes by standard veni-puncture method. Genomic DNA was extracted from whole bloodsamples using the MagNA Pure Compact Nucleic Acid Isolation Kit I(Roche, Mannheim, Germany) following the manufacturer’sinstructions.Analysis of Polymorphisms in GenesAll polymorphisms were genotyped by restriction analysis afterpolymerase chain reaction (PCR) ampliﬁcation. Thirty-ﬁve cyclesof PCR were performed on a thermal cycler (GeneAmp9700;Perkin-Elmer Cetus, Norwalk, Connecticut, United States). Primerswere synthesized (VWR International Eurolab, Barcelona, Spain).The PCR reaction consisted of 50 ng DNA, 10 pm of each primer,10 ml PCR master mix (Promega, Madison, Wisconsin, UnitedStates) and up to 20 ml water.TLR2 p.R677W (rs5743706) PCR primers were 50CAATCCC-CCCTTCAAGTTG-30 and 50-CAGTTCATACTTGCACCACTC-30. Thecycle program consisted of 94 8C for 30 s, 58 8C for 30 s, and72 8C for 30 s. SsiI (Fermentas, Burlington, Canada).TLR2 p.R753Q (rs5743708) PCR primers were 50-GAAGAGAA-CAATGATGCTGCCATTC-30 and 50CTAGGACTTTATCGCAGCTCTC -30.The cycle program consisted of 94 8C for 30 s, 49 8C for 30 s, and72 8C for 30 s. SsiI (Fermentas, Burlington, Canada) (Fig. 1).TLR4 p.D299G (rs4986790) PCR primers were 50-ACTTAGAC-TACTACCTCGGTG-30 and 50-GATTTGAGTTTCAATGTGGGAAAC-30.The cycle program consisted of 94 8C for 30 s, 53 8C for 30 s, and72 8C for 30 s. HphI (Fermentas, Burlington, Canada).TLR4 p.T399I (rs4986791). PCR primers were 50-TCTCAAAGT-GATTTTGGGACGA-3 and 50-GTTCTCAAAGTGATTTTGGGAATG-30.The cycle program consisted of 94 8C for 30 s, 56 8C for 30 s, and72 8C for 30 s. MboI (Fermentas, Burlington, Canada).CD14 c.-159C>T (rs2569190) PCR primers were 50-TCACCTCCC-CACCTCTCTT-30 and 50-CCTGCAGAATCCTTCCTGTT-30. The cycleprogram consisted of 94 8C for 30 s, 59 8C for 30 s, and 72 8C for30 s. HaeIII (Roche, Mannheim, Germany).Statistical AnalysisAll statistical analyses were performed using SPSS Inc. version15.0 (SPSS Inc., Chicago, Illinois, United States). Genotype (TLR2R677W, TLR2 R753Q, TLR4 D299G, TLR4 T399I, and C-159T CD14)distribution was tested with Hardy-Weinberg equilibrium inpatient and control groups.10 Student’s t-test was used for thecomparison of numeric variables within groups and the Pearsoncorrelation test for the correlation of numeric variables. The x2test and Fisher’s exact test (when appropriate) were usedfor comparison of groups. The data were expressed as mean standard deviation, and statistical signiﬁcance was accepted as aP-value .05.Logistic regression was used to estimate the effect of TLR2R753Q genotypes on the odds of a patient having the phenotypefor infective endocarditis under three genetic models (recessive,co-dominant, and dominant), as has been done previously.11RESULTSEndocarditis was of a community origin in 44 (67.7%), a priorcardiopathy was detected in 39 (60%), signiﬁcant risk factor wasidentiﬁed in 31 (47.7%), and predisposing diseases as follows:diabetes mellitus 12 (18.5%), alcoholism 6 (9.2%), cancer 4 (6.1%),chronic renal failure 3 (4.6%), chronic obstructive pulmonarydisease 6 (9.2%). Gram-positive bacteria were detected as acausative agent in 50 (76.9%) patients (46.1% Staphylococcus and30.8% Streptococcus), while Gram-negative bacteria were theetiologic agent in 5 (7.7%) patients. No causative agent wasisolated in 9 (13.8%) patients and 39 patients (60%) needed surgicaltreatment and the hospital mortality rate was 30.8% (n = 20).Distribution of Genotypes and Allele Frequencies in Patientsand Control GroupIn the analysis of genes (Table 1), signiﬁcant associations withinfective endocarditis were seen for TLR2 R753Q, for both thegenotype (P = .001) (Fig. 2) and the allele variants (P = .0001). Noassociation was found with other polymorphisms. The genotypeand allele frequencies of the TLR2 R753Q polymorphism weresimilar to frequencies reported from other available Caucasiandata.Further analyses were undertaken, using logistic regression toevaluate the signiﬁcant TLR2 R753Q variants, 3 genetic modelsto test for the effect of the higher-risk genotype compared withthe lowest-risk genotype, and the odds of having the infectiveTable 1Distribution of Toll-Like Receptor 2, 4 and CD14 Gene Polymorphisms in Endocarditis Patients and ControlsGenepolymorphismGenotypefrequenciesEndocarditisn = 65Controlsn = 66Pearsonx22P-value AllelefrequenciesEndocarditis Controls OR (95% CI) Pearsonx22P-valueTLR2 R677WCC 36 (55.4) 41 (62.2)1.3393 .5119C 95 (73.1) 104 (78.8) 0.731 [0.413-1.291] 1.1696 .2795TC 23 (35.4) 22 (33.3) T 35 (26.9) 28 (21.2)TT 6 (9.2) 3 (4.5)TLR2 R753QR/R 30 (46.1) 50 (75.8)13.8662 .001R 87 (66.9) 115 (87.1) 0.299 [0.16-0.56] 15.1335 .0001R/Q 27 (41.6) 15 (22.7) Q 43 (33.1) 17 (12.9)Q/Q 8 (12.3) 1 (1.5)TLR4 D299GD/D 53 (81.5) 60 (90.9)2.6762 .2624D 117 (90) 125 (94.7) 0.504 [0.194-1.307] 2.049 .152D/G 11 (16.9) 5 (7.6) G 13 (10) 7 (5.3)G/G 1 (1.5) 1 (1.5)TLR4 T399LT/T 60 (92.3) 59 (89.4)1.0084 .604T 125 (96.2) 124 (93.9) 1.613 [0.513-5.066] 0.6811 .409T/I 5 (7.7) 6 (9.1) I 5 (3.8) 8 (6.1)I/I 0 (0) 1 (1.5)CD14 C-159TC/C 20 (30.8) 21 (31.8)0.493 .7815C 70 (53.8) 75 (56.8) 0.887 [0.545-1.443] 0.2341 .628C/T 30 (46.1) 33 (50) T 60 (46.2) 57 (43.2)T/T 15 (23.1) 12 (18.2)CI, conﬁdence interval; OR, odds ratio; TLR, toll-like receptor.Values are expressed as no. (%).1009080706050403020100Endocarditis ControlsR/RR/QQ/QP = .001Prevalence of genotype (%)Figure 2. Prevalence of the genotypes corresponding to the endocarditis andcontrol groups for the polymorphism toll-like receptor 2 R753Q.J. Bustamante et al. / Rev Esp Cardiol. 2011;64(11):1056–10591058endocarditis phenotype (Table 2). All three genetic models weresigniﬁcant, the co-dominant one carrying the highest risk. For therecessive and co-dominant models the odds ratio (OR) forgenotype effects on having infective endocarditis phenotype were9.12 and 13.33, respectively, while the OR of the dominant modelwas 3.65.DISCUSSIONThis is the ﬁrst study to show that the TLR2 R753Qpolymorphism is associated with a signiﬁcant increased risk ofTable 2Logistic Regression Analysis of Toll-Like Receptor 2 R753Q Genetic Variants AssocGenetic variant and reference SNP Recessive model OR (95% CI) P value TLR2 R753Q 9.12 (1.11-75.18) .04aCI, conﬁdence interval; OR, odds ratio; SNP, single nucleotide polymorphisms; TLR, tolOR are presented for the highest-risk genotype as compared with the lowest-risk genoThe number of patients (131) reﬂects the genotypes available. Speciﬁc genotype compa The values are for the comparison of the QQ genotype with the combined R/Q andb The values are for the comparison of the QQ genotype with RR genotype.c The values are for the comparison of the combined R/Q and QQ genotypes with thinfective endocarditis, and that co-dominant, recessive anddominant genotypes are associated with the infective endocarditisphenotype.SNPs R677W7 and R753Q8 within the gene encoding TLR2have previously been reported to carry a risk of infectiousdiseases.The R753Q polymorphism was ﬁrst identiﬁed by Lorenz et al.6 Apositive association has also been reported with Mycobacteriumtuberculosis and with acute rheumatic fever caused by Gram-positive bacteria (b-hemolytic Streptococcus).12 Previous studiesare in concordance with our ﬁndings. On the other hand, in a studyof 420 consecutive patients with severe S. aureus infection, Mooreet al. found no association with this SNP.13Regarding the TLR2 R677W SNP, no differences were observedin the distribution of the genotypes or alleles in our study. This isconsistent with data in the literature, as this polymorphism hasonly been identiﬁed in Asian populations with lepromatousleprosy, and not in Caucasian European populations.7In contrast, the SNPs TLR4 D299G and C-159T CD14 do have apositive association with several infectious diseases, such as septicshock due to Gram-negative bacteria.4,8,9 In our study, no positivecorrelation was found with infective endocarditis, perhaps becauseonly 7.7% of the patients in our study had infective endocarditisdue to Gram-negative bacteria.In conclusion, we found that the polymorphism of the TLR2R753Q leads to increased susceptibility to infective endocarditis. Itis necessary to reproduce the study of population groups withdifferent characteristics in order to prove the validity of the resultsand identify other genetic factors associated with an increased riskiated With Infective Endocarditis (All Patients, n = 131)Co-dominant model Dominant modelOR (95% CI) P value OR (95% CI) P value13.33 (1.59-111.92) .017b 3.65 (1.73-7.69) .001cl-like receptor.type.arisons are listed below. RR genotypes.e RR genotype.J. Bustamante et al. / Rev Esp Cardiol. 2011;64(11):1056–1059 1059of infective endocarditis, given the importance of the variability intheir genetic make up.FUNDINGThis work was supported by the Gerencia de Salud, Consejerı´a deSanidad, Junta de Castilla y Leon [GRS 143/A/07], by Redes Tema´ticas,RD06/0001/0020 and by Obra Social Caja Burgos.CONFLICTS OF INTERESTNone declared.REFERENCES1. King JW, Nguyen VQ, Conrad SA. Results of a prospective statewide reportingsystem for infective endocarditis. Am J Med Sci. 1988;295:517–27.2. San Roma´n JA, Lo´pez J, Vilacosta I, Luaces M, Sarria´ C, Revilla A, et al. Prognosticstratiﬁcation of patients with left-sided endocarditis determined at admission.Am J Med. 2007;120:369.e1–7.3. Mylonakis E, Calderwood SB. Infective endocarditis in adults. N Engl J Med.2001;345:1318–30.4. Schro¨der NW, Schumann RR. Single nucleotide polymorphisms of Toll-likereceptors and susceptibility to infectious disease. Lancet Infect Dis. 2005;5:156–64.5. Cook DN, Pisetsky DA, Schwartz DA. Toll-like receptors in the pathogenesis ofhuman disease. Nat Immunol. 2004;5:975–9.6. Lorenz E, Mira JP, Cornish KL, Arbour NC, Schwartz DA. A novel polymorphism inthe toll-like receptor 2 gene and its potential association with staphylococcalinfection. Infect Immun. 2000;68:6398–401.7. Kang TJ, Chae GT. Detection of toll-like receptor 2 (TLR2) mutation in thelepromatous leprosy patients. FEMS Immunol Med Microbiol. 2001;31:53–8.8. Agnese DM, Calvano JE, Hahm SJ, Coyle SM, Corbett SA, Calvano SM, et al.Human toll-like receptor 4 mutations but not CD14 polymorphisms are asso-ciated with an increased risk of Gram-negative infections. J Infect Dis.2002;186:1522–5.9. Sutherland AM, Walley KR, Russell JA. Polymorphisms in CD14, mannose-binding lectin, and Toll-like receptor-2 are associated with increased preva-lence of infection in critically ill adults. Crit Care Med. 2005;33:638–44.10. Guo SW, Thompson EA. Performing the exact test of Hardy-Weinberg propor-tion for multiple alleles. Biometrics. 1992;48:361–72.11. Drumm ML, Konstan MW, Schluchter MD, Handler A, Pace R, Zou F, et al.; GeneModiﬁer Study Group. Genetic modiﬁers of lung disease in cystic ﬁbrosis.N Engl J Med. 2005;353:1443–53.12. Berdeli A, Celik HA, Ozyu¨rek R, Dogrusoz B, Aydin HH. TLR-2 gene Arg753Glnpolymorphism is strongly associated with acute rheumatic fever in children.J Mol Med. 2005;83:535–41.13. Moore CE, Segal S, Berendt AR, Hill AV, Day NP. Lack of association betweenToll-like receptor 2 polymorphisms and susceptibility to severe diseasecaused by Staphylococcus aureus. Clin Diagn Lab Immunol. 2004;11:1194–7.

Toll-Like receptor 2 R753Q polymorphisms are associated with an increased risk of infective endocarditis

http://uvadoc.uva.es/bitstream/10324/15414/1/PD-293.pdf

Toll-Like receptor 2 R753Q polymorphisms are associated with an increased risk of infective endocarditis

Abstract

Similar works

Full text

Available Versions

Repositorio Documental de la Universidad de Valladolid